Exercici entregable BLAST (BIA) (Part genètica) (2017)

Trabajo Catalán
Universidad Universidad de Girona (UdG)
Grado Biología - 3º curso
Asignatura Bioinformàtica Aplicada
Año del apunte 2017
Páginas 2
Fecha de subida 01/07/2017
Descargas 0
Subido por

Descripción

Inclou l'exercici entregable corresponent a la sessió de BLAST de la part genètica de l'assignatura de Bioinformàtica Aplicada (BIA) (Part genètica)

Vista previa del texto

Natalia Mingorance García 3r Biologia – UdG UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA Cercar informació sobre una seqüència desconeguda Estàs treballant en un laboratori i has clonat i seqüenciat el fragment de DNA següent: >seqüència clonada CAACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAACAGCAGCAACAAC AGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAGCAAG CGAAAGAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAATTGGCAGCCCAGCAGC TTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCAGCAGCATCT GCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTT CCTGTCCAATCGCTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTAT GGAAAGAAGTGACTGGAGTTCACAGTATGGAAGACAATGGCATTAAACATGGAGG GCTAGACCTCACTACTAACAATTCCTCCTCGACTACC En primer lloc vols esbrinar si aquest fragment ja ha estat seqüenciat prèviament, ja que en aquest cas potser la seqüència ja ha estat caracteritzada per altres investigadors i pots trobar informació sobre ella en les bases de dades corresponents.
Les preguntes que has de respondre són: a) A quina espècie pertany la seqüència? Pertany a Homo sapiens.
b) Correspon aquesta seqüència a un gen o a una regió no codificant del genoma? Si és un gen, de quin es tracta? La seqüència correspon al gen foxP2 (forkhead box P2).
c) Hi ha seqüències homòlogues en altres espècies properes? En quines espècies? Anomena cinc espècies.
Sí. Pan troglodytes, Papio anubis, Gorilla gorilla, Pongo pygmaeus i Macaca mulatta.
Un cop ja saps de quin gen es tracta, vols veure què es coneix sobre aquest gen i la seva funció. Contesta les següents preguntes (utilitza la base de dades Gene): d) En quin cromosoma es troba aquest gen? Al cromosoma 7.
e) Quins gens té al seu costat? Figura 1. Localització i gens propers al gen foxP2.
MDFIC i PPP1R3A, tal i com es pot veure a la Figura 1.
Natalia Mingorance García 3r Biologia – UdG UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA f) Quins efectes fenotípics té la mutació d’aquest gen, causa alguna malaltia? (Ves a la base de dades OMIM) Mutacions del gen foxP2 poden provocar un desordre de la capacitat per parlar i del llenguatge oral (speech-language disorder) als humans.
Un cop tens aquesta informació vols obtenir més informació sobre la funció del gen.
Contesta les següents preguntes (UniGene): g) Quantes isoformes es coneixen d’aquest gen en humans? Hi ha 8 isoformes d’aquest gen en humans.
h) Quina localització cel·lular té i en quins teixits s’expressa? El gen foxP2 es localitza al nucli de les cèl·lules humanes. Aquest gen es pot expressar en un ampli ventall de teixits, com són el cervell, el ronyó, el fetge, la pròstata, la pell, la boca, l’úter, el teixit embrionari, l’orella, les glàndules mamàries, la tràquea, els testicles, els intestins, els ulls, els pulmons, els músculs, el cèrvix, les tiroides, els ossos i els nervis.
...

Tags:
Comprar Previsualizar