Genética molecular 19 (2017)

Apunte Español
Universidad Universidad Complutense de Madrid (UCM)
Grado Medicina - 2º curso
Asignatura Genética Molecular
Año del apunte 2017
Páginas 8
Fecha de subida 13/05/2017
Descargas 3
Subido por

Vista previa del texto

Tema 17. La replicación en humanos En los cromosomas humanos existen múltiples orígenes de Replicación Ori, que se disponen a lo largo de un cromosoma a distancias de 50 Kb a 100 Kb (70 Kb de media). La unidad de replicación (70 Kb) se denomina Replicón.
En el ser humano también existen DNA polimerasas más procesativas (síntesis y reparación de grandes extensiones) y otras que son menos procesativas (participación en determinadas vías del daño). Es decir, el DNA humano cuenta con varias DNA polimerasas, así como DNA ligasas que tiene cierta especifidad por determinadas funciones.
Otra característica es que el Ori C en bacterias es único y a partir del él se produce la replicación de ambas cadenas en dos direcciones. Si esto fuera igual en el ser humano, sería un proceso muy lento. Supongamos que si una bacteria tiene un tiempo de generación de 20 minutos, en una célula humana que se reproduce más rápidamente en los medios de cultivo, son de 8 horas (teniendo a su disposición todos los elementos necesarios).
Por ello, en humanos los orígenes de replicación se denominan Ori y existen varios, que cubren una media de 70.000 pares de bases a un lado y a otro. Es decir, se abre la burbuja en las dos direcciones. A la estructura que se replica desde un mismo origen se denomina replicón.
A lo largo del cromosoma humano, por tanto, cada 70.000 pb se encuentra un origen hasta los telómeros que se encuentran en los extremos y cuya replicación es un poco distinta, aunque se origina a partir del último Ori, pero tienen algunas características diferenciales.
Las burbujas de replicación se disponen en tándem a lo largo del cromosoma: 71 Además, la replicación será bidireccional en cada burbuja de replicación, que tiene dos horquillas: A secuencias específicas del origen de Replicación Ori se unen un grupo de proteínas que forman un complejo denominado ORC (Complejo de Reconocimiento de Ori).
El Complejo de pre-Replicación (pre-RC) se ensambla durante la las fases M tardía y G1. Se forma por la unión sucesiva al origen de Replicación de ORC y las sucesivas uniones de CDC6 y CDT1.
Una vez iniciada la Replicación se liberan CDC6 y CDT1 para evitar la re-Replicación.
Es decir, tras la replicación y una vez se replica desde el Ori, en vez de tener dos cadenas de cromosoma donde se une el complejo ORC, ahora tenemos dos cromosomas. Cada uno de éstos tendrá su propio origen y por lo tanto, como solo queremos dos copias por cromosomas, el mecanismo para que solo se produzca una copia y no más, es que el proceso de control no se realiza en la fase S (cuando se replica) sino en M tardía o G1. Precisamente cuando se inicia la fase S es cuando se retiran las proteínas (CDC6 y CDT1) que evitan que se produzca la rereplicación.
Por lo tanto, hay tiene que producirse otra vuelta de mitosis y G1 para que vuelva a aparecer este ORC junto con CDC6 y CDT1 y así poder volver a llevar a cabo el proceso de replicación.
Al Complejo de pre-Replicación (pre-RC) se une ahora el Complejo MCM de las Proteínas de Mantenimiento del Minicromosoma, que constituyen un hexámero (de MCM2 a MCM7 y cada una de ellas tiene una función, por ejemplo MCM8 es una helicasa). Cada una de las subunidades del hexámero desarrolla una función característica en los procesos de iniciación y elongación de la replicación. Así, por ejemplo MCM8 es una helicasa.
Estas subunidades son homólogas de las proteínas “Cell Division Cycle” de levadura y por ello reciben nombres alternativos de sus homólogos; por ejemplo MCM4 se denomina también “homóloga de CDC21”. Por lo tanto “CDC” es una nomenclatura específica de levaduras, y encontramos el homólogo en humanos. Participan también en la regulación del ciclo celular.
72 A secuencias específicas del origen de Replicación Ori se unen un grupo de proteínas que forman un complejo denominado ORC (Complejo de Reconocimiento de Ori).
A este Complejo se unen ahora el Complejo MCM de las Proteínas de Mantenimiento del Minicromosoma.
La proteína RPA (Proteína A de la Replicación) es la SSB humana que se une a cadenas sencillas estabilizándolas.
La Primasa, que sintetiza el Cebador de RNA, forma un complejo con la DNA polimerasa alfa. La acción consecutiva de ambas enzimas conduce a la formación de un Cebador RNA – DNA.
73 Una proteína trimérica (PCNA – Antígeno Nuclear de Células Proliferativas obtenida como reacción autoinmune contra proteínas del organismo) forma una abrazadera alrededor de la doble cadena de la cadena parental y el cebador RNA – DNA. Esta abrazadera recluta enzimas requeridas para la Replicación y Reparación del DNA. PCNA recluta el factor de Replicación C y la DNA Polimerasa delta.
La DNA polimerasa delta, que es la procesativa, realiza la polimerización sobre el cebador previamente sintetizado por primasa junto con la DNA polimerasa alfa. Es decir, realiza la síntesis del DNA normal. Las otras DNA polimerasas no tiene la capacidad de sintetizar grandes cantidades de DNA.
El RNA es hidrolizado por la RNAsa H (RIBONUCLEASE H2, RNASEH2A) y la Proteína FEN1 (FLAP STRUCTURE-SPECIFIC ENDONUCLEASE 1). Los Flap (solapas) son estructuras que se forman exclusivamente aquí y se forman en este proceso cuando todavía quedan algunos cebadores.
¿Cuántas polimerasas hay en el SH? o La DNA polimerasa gamma es al DNA polimerasa mitocondrial o La Polimerasa epsilon participa en la corrección de errores o La mayor parte de la Polimerización es realizada por la Polimerasa delta o La Polimerasa delta es altamente Procesativa debido a PCNA, tiene alta fidelidad, y tiene actividad exonucleasa 3´- 5´ o La Polimerasa alfa tiene poca fidelidad pero tiene actividad exonucleasa (correctora) 3´- 5, contrariamente a lo que se afirma en OMIM PCNA o La Polimerasa beta participa en procesos de reparación del daño genético En este caso, al contrario de lo que ocurría con la polimerasa I, el cebador es degradado por la RNAsa H, concretamente H2.
74 Ahora quedan melladuras que serán ligadas por la ligasas. La polimerasa delta elonga los fragmentos de la cadena rezagada pero se pueden formar flaps en el caso de que la RNAsa H no hubiese hidrolizado el cebador previamente. Como no se ha eliminado el cebador, se forman los Flaps. Estos Flaps son muy importantes, la proteína FEN1 es una oncopténa y es la que se encarga de eliminarlos.
Tras la acción de la RNAsa H, de FEN1 y de la DNA Polimerasa delta, ha desaparecido el RNA de los fragmentos de la hebra Rezagada, y ha sido sustituido por DNA, sin embargo siguen existiendo melladuras. Se requiere de la DNA Ligasa para cerrar la Melladura.
El cierre de las melladuras requiere de las enzimas Ligasas humanas, de las cuales encontramos 4 tipos, y son ATP dependientes al contrario de las que habíamos visto de E. coli.
Por lo tanto, primero se produce la activación del fragmento. Al extremo 5’P se le une la unión a AMP mediante hidrolisis de ATP y luego se libera el AMP produciendo la esterificación entre el extremo 3’ y el 5’.
Ligasas en humano o LIGASA I, DNA, ATP-DEPENDIENTE; LIG1: es la más importante en actividad ligasa en células proliferativas humanas. Es decir, es la que participa en el proceso de replicación del DNA.
Las otras ligasas parecen asociadas a procesos de reparación del daño genético o LIGASA IV, DNA, ATP-DEPENDIENTE; LIG4 o LIGASA III, DNA, ATP-DEPENDIENTE; LIG3 75 La Ligasa III y II son isoformas codificadas por el mismo gen. La Ligasa III está implicada en la reparación del daño, pero también parece tener un papel específico en las primeras etapas de la espermatogénesis.
Por último, las topoisomerasas II deshacen las concatenaciones: La replicación de los telómeros Los extremos de los cromosomas lineales representan una excepción en los mecanismos de replicación para cualquier organismo y obviamente también para el humano.
La Replicación de los extremos de los cromosomas utilizando los mecanismos que acabamos de estudiar conduciría a un acortamiento de los cromosomas como podemos ver a continuación: Recordemos que los cebadores son RNA que puede ser sintetizado ex novo. La DNA polimerasa delta ha producido una cadena larga que ha llegado hasta el final. Pero esto es sólo en la dirección 3’-5’. En el extremo 3’hidroxi se producen los cebadores.
Después se rellenar los huecos y las melladuras y se elimina el cebador. Opor lo tanto, la RNas H elimina los cebadores (de ambas cadenas).
Queda un hueco que es más grande de 6 nts.
La polimerasa delta elonga los fragmentos de la cadena rezagada y la ligasa rellena las melladuras (hueco donde estaban los cebadores). Pero quedará un hueco en el extremo 3´ debido a que estaba ocupado por un cebador de RNA que ha sido eliminado. Esto es porque ninguna DNA polimerasa puede sintetizar ex novo, ya que ne cesitan un cebador de RNA o de DNA. Pero en el extremo 3´ya no existe.
76 Sin embargo, encontramos un hueco en el extremo. Las dos cadenas de abajo tiene la misma longitud, pero en la de arriba, la nueva es un poco más corta. Esto pasa en cada generación, ya que ocurriría lo mismo, hasta que se seleccionará un gen vital para la célula y ésta muriera.
Para soslayar el problema, existe un mecanismo de adición enzimática de una secuencia en tándem TTAGGG que se repite en el extremo 3´del telómero, de tal forma que el extremo 3´de cada hebra es algo más largo que su complementario: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 3´ AATCCCAATCCCAAT 5´ La adición de esta secuencia TTAGGG compensará la pérdida de longitud que se produce en cada periodo de replicación.
Es decir, hay un mecanismo que alarga la cadena, o sea, se sintetiza una cadena más corta, pero como se alarga la cadena molde, no nos importa porque en la siguiente generación, el cebador estará en la región “extra” y por lo tanto no será necesario. Para alargar el telómero se encesta la estructura que vemos arriba que está repetida miles de veces, incluso hasta 15000 veces.
La telomerasa es un enzima RNP que posee un snRNA complementario de la secuencia TTAGGGTTAGGG. Por ello podemos decir que es una retrotranscriptasa o DNA polimerasa RNA dirigida.
Por lo tanto, la telomerasa gracias al snRNA, reconoce ese segmento del DNA y añade esta nueva secuencia. Por eso encontramos miles de veces esta repetición. Por lo tanto, si cortamos no pasa nada.
Los telómeros son sintetizados durante la fase S del ciclo celular, al igual que el resto de DNA.
Pueden alcanzar una longitud de 15.000 pb. En cada mitosis se pierden entre 50 y 200 pb.
Esta enzima tiene splicing alternativo, y por ello existen distintas isoformas. Por lo tanto es importante conocer el proceso de splicing alternativo de esta enzima, que la específica en el ser humano se denomina hTERT. Tiene el dominio de una transcriptasa inversa.
Como tiene RNA y pasa a DNA, es una retrotrnscripción. Por lo tanto es un proceso de retrotrnscripción.
77 El gen hTERT de la telomerasa está localizado en la banda subtelomérica 5p15.33 , y por ello se ve afectado por la deleción en el brazo corto del cromosoma 5 causante del síndrome “del maullido de gato”.
78 ...

Tags: