Tema 2: Expresión Génica en procariotas I (2015)

Apunte Español
Universidad Universidad Autónoma de Barcelona (UAB)
Grado Genética - 2º curso
Asignatura Biología molecular de procariotas
Año del apunte 2015
Páginas 10
Fecha de subida 24/11/2015
Descargas 2
Subido por

Vista previa del texto

TEMA 2: EXPRESIÓN GÉNICA EN PROCARIOTAS I En los organismos procariotas la transcripción y la traducción están acoplados, incluso se dice que son simultáneos.
Antes de que se termine de transcribir todo el gen, empieza a traducirse parte del transcrito.
La estructura principal presente en el proceso es el POLISOMA, que es el complejo de DNA, RNA, ribosomas, polipéptidos, RNApolimerasa…) ESTRUCTURA DE LOS GENES BACTERIANOS En el transcrito (mRNA): Tendremos una REGIÓN LÍDER en la que encontramos regiones RBS (ribosom binding site) o SD (Shine-Delgarno). Esta región líder se encuentra en el inicio del transcrito, puesto que las regiones RBS son las encargadas de unirse a los ribosomas para la traducción. Por tanto, cerca de estas regiones líder encontramos los codones de inicio, que por lo general suelen ser codones para la metionina. (AUG) En el otro extremo del transcrito se sitúa la REGIÓN TRAILER en la que encontramos loops etc. en definitiva encontramos zonas de regulación. Cerca de estas regiones se encuentran los codones STOP, estos son tres: el ámbar, sepia y ocre.
No es lo mismo el inicio de transcripción que el de traducción, y además ambos inicios no coinciden.
El inicio de la transcripción se llama “+1”, que es donde se pone el primer nucleótido. Todos los transcritos (mRNA) comienzan por A o G.
El ADN tiene una CADENA CODIFICANTE y otra CADENA MOLDE. La cadena molde es la que se copia, es decir el transcrito (mRNA) será complementario a la cadena molde. El transcrito será idéntico a la cadena codificante a excepción de que al ser RNA en vez de Timinas encontraremos Uracilo en el transcrito.
En la cadena codificante encontramos la región ORF (open reading frame). Es un trozo de DNA en la que está incluida la cadena codificante, o sea es un posible gen que codifica para una proteína (tripletos sin ningún stop). Decimos posible gen porque la transcripción no solo depende de esta región es necesaria la presencia de promotores etc.
El transcrito siempre tendrá dirección 5’3’.
Cualquier secuencia de DNA tiene 6 marcos de lectura (6 frames).
1 Si se cambia el sentido de la lectura la cadena molde pasa a ser la codificante y viceversa. Solamente uno de los frames es válido porque en los otros aparecerán muchos tripletes STOP y el transcrito no se podrá traducir.
Pueden coincidir genes por lo que el producto será uno u otro pero cada uno será un ORF.
UNIDADES TRANSCRIPCIONALES Existen diferentes tipos. Es lo que se transcribe a partir de un promotor gracias a la RNApolimerasa.
Unidades MONOCISTRÓNICAS: el transcrito contiene un único ORF.
Unidades POLICISTRÓNICAS: en transcrito contiene más de un ORF. (normalmente estos ORFs tienen una relación funcional).
*CISTRÓN = GEN* EFECTO POLAR SOBRE LA TRADUCCIÓN *La presencia de ribosomas también protegen de ribonucleasas. Mutaciones que acaban la traducción de forma temprana facilitan la acción de estos encimas que degradan el mRNA* En las unidades policistrónicas se transcriben y traducen más de un gen simultáneamente. Antes hemos mencionado que la transcripción y la traducción son casi simultáneas de manera que la pregunta que nos viene a la cabeza es si todos los genes se traducirán creando mismas concentraciones de los productos (¿1=2=3?) La respuesta es que NO!! Las concentraciones relativas de los productos (proteínas) sería 1>2>3 porque el ribosoma se suelta al llegar al STOP pero como muy cerca tenemos un RBS se une el mismo ribosoma y sigue traduciendo el 2 etc. Esto teniendo en cuenta que todos los RBS de la unidad policistrónica son iguales.
Además la señal de degradación se encuentra en el extremo 3’ y se degrada en  en esta dirección por lo que el cistrón 1 tiene más tiempo de traducción.
2 Hay plegamiento en la cadena ARNm en las zonas más alejadas, es decir en las zonas más cercanas al extremo 3’. Estos plegamientos se forman gracias a uniones entre zonas RBS. Si el RBS está en el plegamiento los ribosomas no lo reconocerán.
Estos plegamientos son interesantes porque si tenemos muchos ribosomas avanzando en la cadena evita que en la zona 3’ los RBS sean reconocidos por otros ribosomas.
La célula aprovecha el efecto polar para regular la expresión de genes, colocándose en las unidades transcripcionales el principio (1) los genes de interés AGGAGACTTTCAGATGTTAATCCT En unidades policistrónicas nos podemos encontrar en situaciones como esta en la que tendremos el RBS antes que el codón STOP del primer cistrón.
¿Propone esto un problema? Puede parecer que si porque al llegar al STOP el ribosomas que está traduciendo se desensambla pero esto no significa que el segundo cistrón no se traduzca porque el RBS este antes en la cadena de mRNA.
3 NO es ningún problema. Para explicar esto tendremos que tener en cuenta como ocurre la traducción en sí. El primer nucleótido que se unirá para poder empezar la traducción es la metionina (GAG o AUG). Esto se debe a que el primer tRNA es el de la metionina. El ribosoma se une al RBS y una vez unida se mueve buscando el codón de la metionina a lo largo de la mRNA hasta que lo encuentre sin pararse en traducir los codones que se salte en este periodo.
Por tanto, que el RBS esté antes que el STOP no crea ningún problema, puesto que cuando el ribosoma llegue al STOP se desensamblará y buscará un nuevo RBS que en este caso estará  pero eso no es relevante. Una vez allí el ribosoma que tendrá tRNA para la metionina buscará el codón de inicio y no reparará en el STOP que ha tenido cuenta en la traducción previa. Cuando encuentre el codón de inicio unirá la metionina y comenzará la lectura del transcrito.
MUTACIONES POLARES La afinidad de los ribosomas por los RBS son variables, esto se debe a que no todos los RBS son iguales. De manera que si en una unidad policistrónica de 3 cistrones, el RBS del tercero es mucho más afine que el primero el efecto polar que hemos comentado previamente será mucho menor.
Ahora las mutaciones polares son algo diferente. Si en el primer cistrón encontramos un codón de stop (mutación sin sentido), esto dificultará la unión del ribosomas disociado al siguiente RBS, porque no estará o no tiene por qué estar en una región cercana, por lo tanto las estructuras secundarias de las partes 3’ del mRNA no se desharán de manera que será muy difícil traducir los citrones adyacentes a partir del punto del que ocurre la mutación.
Por tanto una mutación polar es una mutación que además de tener efectos propios en el gen, también afecta a los genes colindantes.
En este tipo de situaciones no podemos decir que tenemos una mutación a nivel genotípico, pero la falta de producto es evidente, por lo que decimos que es una mutación fenotípica.
Vemos un mRNA del operón lac en el proceso de ser traducido. Cada gen tiene su propio ribosome binding site y AUG codón de iniciación para la traducción.
4 PROMOTORES BACTERIANOS Los promotores bacterianos están formados por varias regiones gracias a las cuales el promotor es reconocido y se puede sintetizar el transcrito.
Región -35: Es la región de reconocimiento de que hay un promotor.
Región -10 (Región TATA o Pribnow): Es la región de anclaje de la polimerasa.
(Ambas regiones son regiones que forman parte del promotor pero solo influyen en el reconocimiento).
En función de la afinidad hay dos tipos de promotores: -Promotores fuertes -Promotores débiles Ambos promotores se clasifican dependiendo de la afinidad de la RNA polimerasa por las regiones. (El promotor débil se alejaría del promotor óptimo del RNApol).
Hay que tener en cuenta que no todas las especies bacterianas tienen las mismas secuencias -35 y -10.
El contenido de G-T afecta bastante el óptimo para la RNA polimerasa, este promotor óptimo varía en diferentes especies.
A pesar de todo esto la estructura de la RNApolimerasa es una estructura muy conservada por lo que también lo son los promotores, esto es, si ponemos un promotor de un organismo en otro es muy posible que siga funcionando como tal, tal vez no sea todo lo fuerte que podía ser en el organismo original, pero aun así seguirá siendo reconocido por la RNApol.
Puede existir más de un promotor en la misma región, de esta manera incrementan los mecanismos de regulación y modulación del a expresión génica.
5 a) Promotores continuos (pueden funcionar los dos a la vez o cada uno por separado) b) Solapados (el reconocimiento de uno de los promotores excluye el reconocimiento del otro) c) Enfrentado (cuando se exprese uno el otro no lo hará) d) Opuestos (cuando uno sea reconocido, debido al inmenso tamaño de la RNApol el otro quedará tapado y por tanto irreconocible) e) Generan productos diferentes ( por ejemplo en una unidad policistrónica) Región +1 (inicio), pues la región -10 se sitúa 10 bases más o menos antes.
Existe una región UPS(upstream) y otra DSP (downstream), son zonas donde se situaran proteínas (factores) que modulan la transcripción.
*Normalmente los moduladores activadores o positivos se sitúan en la región UPS y los inhibidores o moduladores negativos se situan en la región DSR* INICIO DE LA TRANSCRIPCIÓN Es necesaria una curvatura concreta del DNA para que funcione la RNA polimerasa. Normalmente esto no pasa, es decir, por lo general la curvatura presente en el DNA no es la idónea, es por esto que hay proteínas se unen a los UPS para crear dicha curvatura.
Además se necesita que la distancia entre las regiones -35 y -10 sea la óptima porque es posible que no sea así.
6 Que esta distancia no sea la óptima es una manera de regular la transcripción, puesto que existen proteínas que se reconocen entre ellas y se unen a zonas concretas (PE1, PE2) de manera que crean la distancia concreta.
La RNA polimerasa reconoce y se une a las secuencias -35 y -10, si esta distancia es la óptima la síntesis del transcrito también lo será y por tanto la síntesis de la proteína en cuestión también.
RNA polimerasa Es una encima con dos regiones claramente diferenciables. (Todos los genes relacionados con la RNApol se llaman rpo).
rpoB subunitat β → unió nucleòtids rpoC subunitat β’ → unió DNA motlle rpoA subunitat α → unió al promotor rpoD subunitat σ→ reconeixement de la regió -35 i unió -10 Las subunidades α, β y β’ forman lo que llamamos el núcleo de la polimerasa o el “core”.
La subunidad σ es la que al unirse al core o núcleo. Cuando las cuatro subunidades están unidas decimos que es una HOLOENCIMA. Esta holoencima reconocerá las regiones -35 y -10 gracias a la subunidad σ y una vez la holoencima está unida al DNA, la subunidad sigma se soltará.
El core se encarga de la transcripción mientras que la subunidad σ se encarga del reconociemiento.
Existen diferentes subunidades σ con secuencias óptimas diferentes, de manera que dependiendo de la subunidad σ unida al core la afinidad del PROMOTOR cambiará.
7 Por lo que un promotor sea fuerte o débil dependerá mucho de las subunidades sigma que tenga la célula.
Modificando la expresión del gen de las subunidades σ podremos modular el porcentaje de transcripción de muchos genes.
Dependiendo del estadio de desarrollo en el que esté el organismo varía la concentración de las subunidades σ presentes, de manera que también lo hacen las expresiones de los genes.
Una vez se ha producido el reconociemiento y el core de la polimerasa está anclado, la subunidad σ se escindirá y por tanto podrá comenzar a transcribir, pero mientras no se escinda el canal de salida de la polimerasa está bloqueado.
La DNApolimerasa y la RNApolimerasa actúan de manera muy diferentes, mientras que las hebras de DNA se abren antes de que actue la polimerasa, en el case de la RNA polimerasa, la apertura ocurre dentro de la estructura de la polimerasa, además es la misma molécula la que evitará el superrenrollamiento del DNA.
INICIO DE LA TRANSCRIPCIÓN II Una vez la polimerasa está unida (cuando aún no se ha escindido la subunidad σ) el complejo está cerrado. Dentro de la misma polimerasa en la región -10 (TATA) se romperán los puentes de hidrogeno de manera que se abren las cadenas.
En este punto la polimerasa comienza a poner los primeros tres nucleótidos en la región +1, el primer nucleótido será A o G. La subunidad σ tapa la salida del mRNA, por lo que hasta que se escinda la polimerasa no podrá avanzar.
La subunidad σ sigue unida porque le da estabilidad a la holoencima, una vez se escinda comenzará la transcripción y la polimerasa será muy estable, con una vida media muy alta. Si esta se suelta no se podrá volver a unir, dado que necesita la subunidad σ para el reconocimiento del promotor.
MECANISMOS DE FINALIZACIÓN DE LA TRANSCRIPCIÓN La finalización de la transcripción ocurre gracias a terminadores transcripcionales. En el momento que se detiene el avance de la RNApolimerasa, la hebra de DNA que estaba abierta se volverá a cerrar de manera que ya no se podrá abrir, a no ser que la polimerasa se vuelva a unir en el promotor. La clave por tanto para que se termine la transcripción es que se pare la RNApolimerasa. Esto se hace gracias a bucles que se forman en el trancrito (mRNA), que son estructuras secundarias de esta molécula. Tenemos dos tipos de mecanismos: 1) Mecanismos Rho dependientes.
Está implicada la proteína Rho, que es una helicasa de DNA-RNA (desengancha el RNA del DNA). Tiene 6 subunidades idénticas formando un anillo y reconociendo una secuencia específica del RNA. Esta proteína circulara 8 sobre el RNA hasta llegar a la RNA polimerasa, cuando llegue hará que la velocidad de la polimerasa disminuya lo que hará que la polimerasa se disocié del DNA.
Llega a la RNA polimerasa porque la región de RNA que reconoce está muy cerca de la polimerasa.
Además de esto las proteínas Rho tienen una zona de interacción dentro de los bucles que se forman en el mRNA que son ricos en AU y los estabiliza. Estos bucles también hacen que se disminuya la velocidad de la polimerasa, es decir, tiene el mismo efecto.
*Si existe una mutación polar, o mutación de STOP que hace que los ribosomas no estén presentes la proteína Rho llega antes hasta la zona de la polimerasa por lo que el trancrito será mucho más corto. (Llegará antes porque si hay presencia de ribosomas la proteína Rho tiene que ir detrá de ellas y esperar hasta que terminen su transcripción).
2) Mecanismos independientes de la proteína Rho.
Cuando el mRNA se está trancribiendo puede formarse un loop en las regiones ricas en GC. Este loop va seguido de secuencias ricas en AU. La presencia de este loop es suficiente para disociar la polimerasa porque hará que se disminuya su velocidad y además al tener AU en la zona que se está trancribiendo y debido a sus únicos dos puentes de hídrogeno, hace que el RNA se disocie del DNA.
SÍNTESIS DE rRNA y tRNA Los genes que codifican para rRNA se denominan rrn y se encuentran unidos en unidades transcripcionales policistrónicas. Los rrn no solo codifican lara rRNA sino que también para tRNA. Hay muchas copias de este tipo de gen a lo largo del genoma, cada copia tiene sus diferencias en secuencia, promotor etc. Por tanto a partir de un promotor se creará un transcrito policistrónico, el transcrito primario. Este transcrito por la acción de endonucleasas y exonucleasas se convertirá en elementos funcionales o transcritos secundarios.
En el caso de los tRNA , también hay genes específicos para la síntesis de tRNA en concreto, que se transcribirá y por la acción de endonucleasas y exonucleasas serán funcionales.
*Todos los tRNA tienen una región muy conservada que no siempre obtienen por la transcripción, si este es el caso existe un encima que les transferirá de esta región concreta (tRNA nucleotidil transferasa).
9 Esta secuencia es la que reconocerá el codón y hará que se coloque el AA correspondiente en otra zona del tRNA.
CONTROL DEL OPERÓN rrnB La cantidad de mRNA o transcrito que se sintetiza depende mucho de la torsión que tiene el DNA en la zona del promotor, de manera que si es la correcta la RNA polimerasa puede unirse y transcribir.
Esto se puede controlar por algunas NAPs concretas.
Proteina FIS, crea la torsión óptima para la polimerasa de manera que esta puede actuar y veremos como consecuencia un aumento en la expresión de rRNAs. Este tipo de situación la observaremos cuando la célula se encuentre en un medio con muchos nutrientes.
Proteina H-NS, su función es la contraria, es decir, da una torsión que no es adecuada para la polimerasa de manera que no se puede anclar y actuar. Este tipo de NAP actúa en el caso de medios escasos.
Como resumen: 10 ...