Problemes Biologia Molecular (Sessió 1 a 5) (2016)

Ejercicio Catalán
Universidad Universidad de Girona (UdG)
Grado Biología - 3º curso
Asignatura Biologia Molecular
Año del apunte 2016
Páginas 21
Fecha de subida 01/04/2016
Descargas 80
Subido por

Descripción

Problemes Biologia molecular: Sessions 1 (problemes 1-7), 2 (problemes (8-13), 3 (problemes 14-19), 4(problemes 20-23) i 5 (problemes 24-27)

Vista previa del texto

Problemes biologia molecular - Sònia Vivo PROBLEMES DE BIOLOGIA MOLECULAR SESSIÓ 1 1. Quina és la seqüència de bases complementària a cada una de les seqüències de bases següents? a. 5’ TGATCAGGTCGAC 3’ b. 5 ’ATATATATATATAT 3’ 3’ ACTAGTCCAGCTG 5’ 3’ TATATATATATATA 5’ Recorda indicar el sentit, és a dir, col·loca on va 5’ i on 3’ o fes una fletxa que ho indiqui. Si no poessis 5’-3’, estaries dient, per exemple, que la complementaria de “a” és 5’ ACTAGTCCAGCTG 3’ i no 3’ ACTAGTCCAGCTG 5’ (sempre 2. Quants topoisòmers pot originar un DNA circular de 95 pb considerant λ = ±0,09?.
Considereu 10 pb/volta d’hèlix. Raonar si pot existir en forma de cercle relaxat.
El topoisòmers són molècules de DNA iguals (mateixa seqüència) però amb un nombre d’enllç diferent.
95 𝑇 = 10= 9,5 voltes Sabem que L=T+W. En la forma relaxada, no hi han superenrotllament i, per tant, W=0. Així doncs L seria igual a T. L, però, sempre ha de ser un nombre sencer i, per tant, ha de ser diferent a 9’5. Així doncs no es pot complir la igualtat L=T i W serà diferent de zero → NO existeix la fase relaxada.
La fase relaxada es dona quan W=0 ja que això indica que no hi ha superenrotllament.
Per trobar els topoisomers hem d’anar canviant la L per sobre i per sota de 9.5 per buscar λ que es trobin entre ±0.09.
𝜆= L=9 → 𝜆 = 9−9,5 = 9,5 L=10 → 𝜆 = L=8 → 𝜆 = L=11 → 𝜆 = -0,052 10−9,5 = 9,5 8−9,5 = 9,5 𝐿 − 𝐿𝑜 𝐿𝑜 0,058 -0.158 11−9,5 = 9,5 0.158 Les L=9 i L=11 estan dins del rang de 𝜆 ± 0,09. L=8 i L=11, en canvi, no ho estan. Així doncs, existeixen dos topoimerases.
1 Problemes biologia molecular - Sònia Vivo 3. A la natura predominen les formes de DNA amb W<0 sobre les superenrotllades positives (W>0). Malgrat tot, en el DNA d’un bacteri termòfil s’han trobat valors de W positius. Raonar quin avantatge selectiu pot representar per aquest bacteri tenir un DNA amb un superenrotllament positiu.
El superenrotllament positiu fa que costi més de desnaturalitzar-se. Els bacteris termòfils són bacteris que viuen en ambients on hi han elevades temperatures. Si tinguessin la W negativa seria més fàcil que les dues cadenes de DNA es separessin (es desnaturalitzes el DNA). Així doncs, si el superenrotllament és positiu serà més difícil que passi ja que tindrà una força contraria a la calor.
És més difícil que es desnaturalitzi quan W>0 ja que el DNA es troba més compactat.
4. Un DNA dúplex circular i tancat té un segment de 100 pb de residus C i G alternats. Quan es transfereix a una solució que conté una elevada concentració salina, aquest segment experimenta una transició des de la conformació B a la conformació Z. Quin és el canvi en el seu número d'enllaç, número de torsió i gir, és a dir ΔL, ΔT i ΔW? 𝛥𝐿 = 𝛥𝑇 + 𝛥𝑊 La B es calcula de la següent manera: (nombre de parells de bases)/(nombre de parells de bases que hi ha a cada volta d’hèlix). El B-DNA, doncs, té una T= 100 = 10 10 (voltes hèlix). Al ser un número enter tindrà una L= 10 (nº de vegades que una cadena creua l’altre) i la W=0 (vegades que s’enrotlla sobre si mateix). El B-DNA, a més, gira en sentit dextrogir, El Z-DNA (provinent del B-DNA anterior), en canvi, tindrà una L= 10 (ja que és un valor que no canvia al canviar el DNA) i una T = 100 = 12 -8,33 (el signe negatiu fa referencia al fet que el Z-DNA gira en el sentit contrari, és a dir, levogir). Així doncs, W= L-T → W= 10 - (-8,33) → W=18,33.
Finalment els increments seran: ΔL= 10-10 → ΔL=0 → L sempre es manté constant.
ΔT= T final - T inicial = -8,33-10 → ΔT=-18,33 Sabem que ΔL=ΔT+ΔW. Per tant, ΔW=ΔL-ΔT → ΔW=0-(-18,33) → ΔW=18,33 5. El bromur d’etidi s’intercala entre les bases del DNA de doble cadena. Per cada molècula intercalada entre parells de bases adjacents es desfà la doble hèlix en un cert grau. És a dir, la fixació del bromur d’etidi redueix el nombre de voltes d’hèlix necessàries sense que la 2 Problemes biologia molecular - Sònia Vivo molècula es desestabilitzi. Això vol dir que afecta el valor de T. Com serà aquest valor, més gran o més petit? a) Si s’afegeix bromur d’etidi a un DNAccc que es troba relaxat, el superenrotllament (W) serà positiu o negatiu? Com que el bromur d’etidi es posarà entre les bases, la T disminuirà, ja que es desfarà la doble hèlix.
Si T disminueix i la L no canvia de valor, la W haurà d’augmentar → superenrotllament positiu.
L=T+W → W=L-T → Si T↓ → W↑ El bromur d’etidi afegeix superenrotllament positiu! b) Quin efecte tindria el bromur d’etidi sobre el superenrotllament (W) si el DNA estigués oscat? Si el DNA està oscat, el superenrotllament es desfà. Així doncs, el bromur d’etidi no afectarà a W.
c) S’ha observat que l’addició progressiva de bromur d’etidi a un DNAccc superenrotllat negativament provoca una disminució progressiva de la mobilitat electroforètica, però en afegir més bromur d’etidi, a partir d’un cert punt aquesta mobilitat torna a incrementar? Com ho explicaries? Com s’observa a la figura següent, el bromur d’etidi s’encarrega de fer passar el DNA amb superenrotllament negatiu a tenir-ne un de positiu. Així doncs, la hèlix primerament s’ha de desplegar i posteriorment s’ha de tornar a plegar en sentit contrari.
S’observa que en afegir una certa concentració de bromur d’etidi, la molècula de DNA es pot desplaçar menys electroforèticament ja que està en estat relaxat, és a dir, menys compactada. Al 3 Problemes biologia molecular - Sònia Vivo afegir més bromur d’etidi, però, la molècula torna a superenrotllar-se i augmenta la seva mobilitat una altra vegada.
6. Indicar quina de les següents operacions induirà la formació d’un superenrotllament: a. Unió dels extrems d’un DNA lineal (no) b. Gir dels dos extrems del DNA lineal seguit de la unió dels extrems (si) c. Unió dels extrems d’un DNA lineal i gir posterior del cercle (no) 7. S'ha descobert recentment un enzim secretat per un determinat bacteri virulent que talla l'enllaç C(2')-C(3') en els residus de desoxiribosa del DNA dúplex. Quin serà l'efecte d'aquest enzim sobre un DNA superenrotllat? No tindrà cap efecte, ja que tallarà la unió entre el carboni 2 i el carboni 3 de la desoxiribosa, i no afectara l’enllaç fosfodiester (entre el carboni a 5’ i 3’ amb el grup fosfat) ni l’enllaç glicosídic (carboni a 1 amb la base nitrogenada). → L’estructura de la cadena no es veurà afectada.
4 Problemes biologia molecular - Sònia Vivo SESSIÓ 2 8. Una proteïna d’unió al DNA s’observa que s’uneix fortament a un DNA de doble cadena dsDNA i molt dèbilment a un DNA de cadena senzilla. Es pot unir a totes les seqüències de bases amb la mateixa afinitat. En una solució amb una concentració de sal 1 M NaCl la unió és molt dèbil. Quin és el lloc d’unió del DNA? S’uneix als grups fosfat: En afegir NaCl, aquest es dissocia en Na + i Cl-. El Na+ apantallarà les carreges negatives dels grups fosfat impedint que les proteïnes s’hi uneixin.
En cadena senzilla, a més, les bases nitrogenades (les quals són hidrofòbiques) estan exposades i aquestes repelaran les proteïnes.
9. Per què és més fàcil obtenir DNA que no pas RNA d’una mòmia egípcia? L’RNA es degrada molt ràpidament ja que: L’RNA conté un grup OH al carboni 2’ el qual pateix més atacs nucleofílic que l’H que té el DNA. Aquest mateix OH, a més, fa un atac nucleofílic al grup fosfat fent que es trenqui l’enllaç fosfodiestes i, per tant, fent que els nucleòtids es separin 10. Quin dels següents factors afectaran la Tm (temperatura per la qual es desnaturalitza el 50% de la molècula) d'un DNA? Per què? Com? a. Força iònica del medi: La T augmentara ja que DNA serà més estable → quan més ions més apantallament dels grups fosfats.
b. Relació G-C/A-T: En augmentar la quantitat de G/C, la T augmentara ja que G/C formen enllaços triples i A/T, en canvi dobles. G/C provoca més estabilitat.
c. Massa molecular: La T augmentara ja que quan més massa molecular, més llarga és la cadena i, per tant, hi hauran més enllaços per trencar, més ponts d’hidrogen i més apilament.
d. Ambient no polar: La T disminuirà ja que provocarà una inestabilitat.
e. Presència d'agents intercalants: La T disminuirà ja que aquests agents provoquen mals aparellaments de bases, obren les cadenes...
f. Presència de proteïnes bàsiques: La T augmentara ja que la cadena s’estabilitzara. Les proteïnes bàsiques tenen càrrega positiva (a pH=7 → PI prot>pH → càrrega +) i apantallaran els grups fosfats.
5 Problemes biologia molecular - Sònia Vivo g. Presència de proteïnes àcides: No afectara a la T ja que la càrrega de les proteïnes és negativa i serà repel·lida pels grups fosfat (a pH<7 → PI prot<pH → càrrega -).
h. Presència de proteïnes neutres: No afectara a la T.
i. pH<2 i pH>11: La T disminuirà ja que la pH inferiors a 2 es trenca l’enllaç glicosídic de manera irreversible (desnaturalització). A pH superiors a 11, en canvi, es dona una ionització completa del fosfat fet que provoca que els grups fosfat es repelin entre ells.
j. Presència de formamida: La T disminuirà ja que la formamida és un agent caotròpic, és a dir, trenca l’estructura secundaria (afecta els ponts d’hidrogen).
k. Agitar la dissolució provocant escuma: La T disminuirà ja que la tensió superficial augmenta fet que fa disminuir l’estabilitat.
l. Presència de formol: El formol és una molècula polar. La T disminuirà ja que el formo afectarà els ponts d’hidrogen i disminuirà l’estabilitat.
11. Es pren una mostra de DNA de timus de vedella i es mesura la seva absorbància a 260 nm, donant 0,7 unitats de densitat òptica (U.D.O.). Quan es desnaturalitza el DNA amb NaOH 0,1 M l'absorbància a 260 nm pren un valor de 0,84. Quina és la seva hipercromicitat? Sabent que la hipercromicitat del DNA de timus de vedella és de 40%, calculeu el % de DNA de doble cadena i de cadena senzilla de la mostra inicial.
Com s’observa a l’enunciat i a la imatge, al passar de DNA “normal” a DNA desnaturalitzat, l’absorbància augmenta (de 0’7 a 0’84 UDO).
Augmentara un: 0,84−0,7 = 0,84 20% (hipercromicitat = (f-i)/i)) El valor obtingut és la meitat de la màxima hipercromicitat (40%). En el 40% és quan tenim tot el DNA desnaturalitzat. Així doncs, com que estem a la meitat, hi haura un 50% de dsDNA i un 50% de ssDNA.
6 Problemes biologia molecular - Sònia Vivo Per saber el % de cadena doble i de cadena senzilla (quan no es veu a cop d’ull) s’utilitza la seqüent fòrmula: 20% x 40% 100%= 50% serà de cadena senzilla. I el altre 50% de cadena doble.
12. Ordenar les molècules de DNA que es mostren a continuació de menor a major temperatura de fusió: Quan més G-C hi hagi, més temperatura de fusió és necessitarà ja que els enllços que formen G/C són més forts (són triples). Així doncs, s’ha de calcular el percentatge de G/C que té cada fragment: a. AAGTTCTCTGAA TTCAAGAGACTT → 4 = 12 33% b. AGTCGTCAATGCAG TCAGCAGTTACGTC → 7 = 14 50% c. GGACCTCTCAGG CCTGGAGAGTCC → 8 = 12 66% Un cop hem calculat els percentatges, tan sols s’ha d’ordenar. El fragment C és el que té una major temperatura de fusió, seguida per B i finalment A.
13. Donada la següent seqüència de RNA, troba l’estructura secundària més estable: GUCCAGCCAUUGCGUUCGCGAUGGC.
7 Problemes biologia molecular - Sònia Vivo SESSIÓ 3 14. A una solució de DNA de cadena senzilla (ssDNA) se li afegeix una exonucleasa (enzim que degrada el DNA per un dels seus extrems). Només se solubilitza una petita part de nucleòtids. Indicar quines possibles raons expliquen la resistència a l’enzim.
Si només es solubilitzen una petita part de nucleòtids pot ser que: • El DNA es trobi plegat sobre sí mateix gràcies a autocomplementarietat. Com que no hi ha una autocomplementarietat perfecte, alguns nucleòtids queden en cadena senzilla i poden ser degradats.
• El DNA sigui circular (passi de lineal a circular).
• Pot haver petit modificacions químiques al laboratori (grups èster, formació de seqüències CAP, inversió del grup P del 5’ al 3’ o l’OH del 3’ ha passat a 5’...). Les inversions es provoquen que les exonucleases no reconeguin bé el DNA i, per tant, no el poden degradar.
15. Una molècula de DNA té la següent estructura: 3’-TACGGGAATTAGAGTCGCAGGATC- 5’ 5’-ATGCCCTTAATCTCAGCGTCCTAG- 3’ La cadena superior és la no-codificant. Quina és la seqüència d’aminoàcids codificada en aquesta molècula de DNA? Al transcriure la cadena no codificant obtenim: 5’ - UACGGGAAUUAGAGUCGCAGGAUC - 3’ Al traduir aquesta seqüència obtenim: Met-Pro-Leu-Ile-Ser-Ala-Ser-STOP 16. Pot existir un plasmidi sense cap gen? Sí però durarà poc. Es pot originar durant la replicació. Mentre té lloc la replicació es va formant un fragment de DNA però per X motius la replicació es para. Aquest fragment de DNA recircularitza i forma el plasmidi sense cap gen. Com que aquest plasmidi no li aporta res a la cèl·lula, serà eliminat.
17. En la digestió del DNA dels bacteriòfags T5 i T7 s’utilitzen els enzims de restricció A i B, respectivament. Es barregen un fragment de T5 i un altre de T7 i es forma una molècula circular de DNA gràcies a l’acció de la DNA lligasa. Què es pot concloure sobre aquests enzims? Que són enzims isocaudòmers. A i B són enzims diferents els quals generen extrems complementars entre ells. Els isocaudòmers són enzims de restricció que reconeixen diferents seqüències de bases 8 Problemes biologia molecular - Sònia Vivo però donen lloc als mateixos extrems (les mateixes cues). Formen extrems cohesius. Exemple: els enzims Sal I i Xho I: Hi han uns altres enzims de restricció anomenats isoesquizòmers. Aquests són enzims de restricció que reconeixen la mateixa seqüència de bases però donen diferent ruptura. Formen extrems Rom.
18. Una molècula de DNA lineal presenta dues dianes per l’enzim de restricció EcoRI, el qual genera extrems cohesius. Quan es digereix aquesta molècula amb EcoRI, quantes molècules de DNA circular es poden formar en presència i en absència de lligasa? Amb DNA lligasa es pot formar 3 molècules de DNA lligasa: la circularització del fragment B, la unió de tots tres fragments A, B i C, i la unió dels fragments A i C.
Sense lligasa nomes es pot formar la molècula circular formada pel fragment B unit amb sí mateix.
Això té lloc ja que es dona complementarietat de bases i no cal que hi hagi una lligasa unint els nucleòtids (Nomes té lloc amb extrems cohesius, els extrems Rom necessiten una lligasa per unirse). Per què tingui lloc aquesta circularització, però, hi han d’haver baixes temperatures.
9 Problemes biologia molecular - Sònia Vivo 19. Sabent que la diana de restricció per EcoRI és 5’G↓AATTC3’ (‘↓’ indica el punt de tall): a. Escriu la seqüència dels extrems d’un fragment de DNA lineal de doble cadena que es generen per digestió amb EcoRI. Indica els extrems 5’ i 3’ de cada fragment.
5’ G_____ 3’ 5’ AATTC 3’ 3’ CTTAA 5’ 3’ ____G 5’ b. Si el fragment de DNA tallat en l’apartat anterior es tracta amb DNA polimerasa i en presència dels 4 desoxribonucleòsids 5’-trifosfat, quina seqüència quedarà? Escriu-la indicant els extrems 5’ i 3’.
5’ GAATT 3’ 5’ AATTC 3’ 3’ CTTAA 5’ 3’ TTAAG 5’ c. Quina seqüència quedaria si es lliguessin els extrems generats en l’apartat b? Escriu-la indicant els extrems 5’ i 3’.
5’ GAATTAATTC 3’ 3’ CTTAATTAAG 5’ d. Escriu la seqüència que quedaria en tractar els fragments de l’apartat a. amb un enzim que tan sols degrada DNA de cadena senzilla.
5’ G 3’ 5’ C 3’ 3’ C 5’ 3’ G 5’ Es degrada tota aquella part de la seqüència que es trobava en cadena senzilla (les cues que sobresurten dels extrems cohesius).
e. Escriu la seqüència resultant del lligament dels extrems generats en l’apartat b. amb els extrems generats en l’apartat d.
5’ GAATT 3’ + 5’ C 3’ → 5’ GAATTC 3’ 3’ CTTAA 5’ + 3’ G 5’ → 3’ CTTAAG 5’ 5’ G 3’ 3’ C 5’ + 5’ AATTC 3 → 5’ GAATTC 3’ + 3’ TTAAG 5 → 3’ CTTAAG 5’ f. En el lligament de l’apartat anterior recuperes alguna seqüència coneguda? Quina? Si, recuperes la seqüència inicial.
10 Problemes biologia molecular - Sònia Vivo SESSIÓ 4 20. Un plasmidi (P) s’analitza mitjançant electroforesi en gel d’agarosa. També s’analitza el producte de la digestió del plasmidi tractat amb HindIII i amb BsuI (per separat). Els resultats del gel d’electroforesi s’indiquen a la figura: Identifica a quin tipus de molècula pot correspondre cada banda.
• Al carril P hi ha carrega un plasmidi. A la banda 1 s’hi troba el plasmidi relaxat i a la banda 2 es troba el mateix plasmidi però superenrrotllat. El plasmidi superenrrotllat està més compactat i, com a conseqüència, pot travessar més els porus del gel d’agarosa.
• Al carril P+Hin dIII hi ha un plasmidi linial. Hin dIII ha produït un tall al plasmidi (només té una diana) i ha provocat que aquest sigui linial. Com a conseqüència, pot corre més que el plàsmid normal però menys que el superenrrotllat.
• Al carril P+BsuI es troba el plasmidi més fragmentat. BsuI té dues dianes al plasmidi. Així doncs, al actuar genera dos fragments. Aquests fragments poden ser més grans o més petits així que poden corre més o menys en el gel. (Si hi hagués un enzim el qual tingues 3 dianes, es formarien 3 fragments → ja que es DNA circular (si fos lineal, 2 dianes significaria 3 fragments i 3 dianes, 4 fragments…)).
21. Quan sotmetem un fragment de DNA lineal a digestió amb diferents enzims de restricció i aquest s’analitza per electroforesi en gel d’agarosa, es troba que cadascuna de les digestions dóna lloc als següents fragments: EcoRI: 1,7 / 0,9 / 0,4 Kpb HpaIII: 1,6 / 1,4 Kpb EcoRI + HpaIII: 1,2 / 0,9 / 0,5 / 0,4 Kpb Deduir l’ordre de les dianes de restricció respecte un origen determinat.
11 Problemes biologia molecular - Sònia Vivo En ser un DNA lineal, quan es formen 3 fragments és perquè l’enzim té 2 dianes (EcoRI) i quan es formen 2 fragments és perquè l’enzim té 1 diana (HpaIII).
Podem veure que les bandes 0.9 i 0.4 es conserven quan tractem el DNA amb els dos enzims a la vegada i que la banda 1.7 (present en EcoRI) desapareix. Aquest fet indica que la diana de Hpa III es troba al fragment de 1.7 d’EcoRI.
Per poder construir el mapa de restricció hem d’anar provant possibilitats fins que n’hi hagi una que sigui equivalent a les bandes que apareixen a EcoRI + HpaIII.
Podem veure a simple vista que el fragment 1.7 no pot anar a els extrems ja que a EcoRI + HpaIII no hi ha cap banda de 0.1 (1.7-1.6) ni de 0.3 (1.7-1.4). Així doncs, el fragment de 1.7 ha d’anar a mig.
Si mirem el patró de bandes de E+H, veiem que hi han les mateixes que les que se'ns han format amb el dibuix anterior. Així doncs, aquest és un possible mapa de restricció.
Aquest segon mapa de restricció també és vàlid. No deixa de ser el mateix mapa que el primer exemple però girat.
En aquest cas veiem que el patró de bandes no ens surt igual. Per tant, aquest no és un possible mapa de restricció. Si el féssim al reves, veuríem que surt el mateix.
12 Problemes biologia molecular - Sònia Vivo Així doncs, el mapa és el següent (o al revès): Recorda posar la mida del fragment i on talla cada enzim (amb la inicial n’hi ha prou). Has de posar tot el que hi ha a l’exemple anterior.
22. El plasmidi pBR607 és circular, de doble cadena i té una longitud de 2,6·106 pb. Aquest plasmidi té dos gens els productes dels quals confereixen resistència a tetraciclina (TetR) i a ampicil·lina (AmpR). El DNA presenta una única diana de tall per cada un dels següents enzims de restricció: EcoRI, BamHI, HindIII, PstI i SalI. El clonatge del DNA en el lloc EcoRI no afecta la resistència a cap dels dos antibiòtics. El clonatge en les dianes BamHI, HindIII, i SalI elimina la resistència a la tetraciclina. El clonatge en la diana PstI elimina la resistència a l’ampicil·lina. La digestió amb els següents enzims de restricció produeix fragments de les mides indicades en la taula. Situar els punts de tall de PstI, BamHI, HindIII i SalI en un mapa de restricció en relació a la diana EcoRI.
El 0.35 del mapa de restricció s’obté de restar 0.55 (la distància entre SalI i EcoRI) i 0.20 (la distància ja recorreguda per arribar a BamHI) → 0.55-0.20=0.35. El mateix passa amb el 0.15 entre HindIII i BamHI. L’1.59 surt de la resta de tots els fragments (0.05+0.15+0.35+0.46) a la longitud total 2.6 → 2.6-(0.05+0.15+0.35+0.46)= 1.59 13 Problemes biologia molecular - Sònia Vivo 23. Estàs estudiant un gen responsable de la biosíntesi d’un pigment en plantes. Tens individus RR (homozigots) que són vermells, individus Rr (heterozigots) que són roses i individus rr (homozigots) que són blancs. El mapa de restricció de l’al·lel R és: Extreus DNA genòmic de plantes vermelles, roses i blanques. Cadascun d’aquests tres DNAs genòmics els digereixes totalment amb EcoRI, HindIII i amb la barreja EcoRI + HindIII, separes els fragments en gel d’agarosa i fas una transferència a membrana de nitrocel·lulosa (Southern). Tens una sonda que és un cDNA obtingut del gen R (el cDNA s’aconsegueix aïllant el mRNA madur i fent una transcripció inversa). Els resultats de l’autoradiografia són els següents: a. Com es veurien aquestes autoradiografies (blanc, negre, amb bandes) si ens oblidéssim de fer alguna de les següents passes del procés: 1. Digerir el DNA amb els enzims de restricció: el DNA seria tan gran que no podria passar pel gel d’agarosa i, per tant, no s’observaria cap banda.
2. Separar les cadenes de DNA amb àlcali: no es veuria res al gel ja que la sonda no podria hibridar a causa que el DNA es trobaria en doble cadena (no es podria fer complementarietat de bases perquè ja està feta amb l’altre cadea).
3. Rentar la membrana després d’afegir la sonda: es veuria senyal per tota la membrana.
Apareixerien molts falsos positius (el gel estaria ple de taques sense sentit).
14 Problemes biologia molecular - Sònia Vivo b. Les bandes que apareixen en les autoradiografies són totes les que es generem amb les digestions? No apareixen totes les bandes. No apareixen perquè no s’ha hibridat.
Les bandes de 0.2, 0.1 i 0.4 no apareixen en el gel.
c. Quina és l’alteració / canvi que es produeix en l’al·lel r respecte al R? En tractar el fragment amb EcoRI obtenim el següent mapa de restricció.
Observem que la banda teòrica de 1.5 no apareix a rr (mirar el gel). En comptes d’una banda de 1.5 trobem una banda de 1.25. Això es deu a que el fragment de 1.5 s’ha escurçat → hi ha hagut una pèrdua de 0.25Kb.
En tractar el fragment amb HindIII obtenim el següent mapa de restricció: Observem que la banda teòrica de 0.3 no apareix a rr (mirar el gel). En comptes d’una banda de 0.3 trobem una banda de 0.05. Això es deu a que el fragment de 0.3 s’ha escurçat → hi ha hagut una pèrdua de 0.25Kb.
Així doncs podem afirmar que la pèrdua de 0.25Kb té lloc dins l’exó 2. Els individus blancs han perdut 0.25Kb entre les dianes 2 i 3 de HindIII.
15 Problemes biologia molecular - Sònia Vivo d. Per què hi ha més bandes en l’autoradiografia del DNA extret dels individus roses? Per què algunes són més febles i en canvi altres mantenen la intensitat? Els individus roses són els Rr. Així doncs, en el seu genoma hi ha la meitat de R i la meitat de r. Com que R i r tenen petites diferències, Rr les agafa d’ambdós individus (Rr té la meitat de cada un dels al·lels, per tant, la banda serà menys intensa en aquelles bandes que difereixen entre RR i rr → bandes a 0.3 i a 0.05).
16 Problemes biologia molecular - Sònia Vivo SESSIÓ 5 24. La digestió amb diferents enzims de restricció i anàlisi electroforètica de les digestions d’un fragment de DNA lineal ha permès determinar els fragments que es produeixen en cada digestió: Establir quin és el mapa de restricció d’aquest fragment de DNA.
És un DNA lineal de 8.6kb (7.0+1.6).
EcoRI → 1 diana BamHI → 3 dianes Hem de buscar l’enzim amb menys dianes per anar resablint el mapa.
EcoRI és el que té menys dianes (1). Hem de mirar on és la diana de EcoRI en els fragments que es formen per BamHI. La banda que desapareix de BamHI quan posem B+E és la de 2.4. Així doncs, la diana de EcoRI es troba en el fragment de 2.4kb.
Podem saber, doncs, que el fragment de 2.4 de BamHI es troba a un extrem, com veurem a continuació: Sabem on està el fragment de 2.4 de BamHI però no podem saber, amb EcoRI, on es troben els altres fragments. Hem de posar un altre enzim de restricció.
EcoRI → 1 diana HaeIII → 1 diana La diana de EcoRI es troba en el fragment de 6.4 ja que aquest desapareix quan es posa H+E.
17 Problemes biologia molecular - Sònia Vivo Com que sabem que la banda de 6.4 es troba al mateix extrem que 1.6, sabem que la banda de BamHI de 2.4 també es troba al mateix costat que 6.4: BamHI → 3 dianes HaeIII → 1 diana La diana de HaeIII es troba al fragment de 2.7 ja que és el que desapareix a H+B.
Sabem que 2.7 no es troba a l’extrem ja que en el patró de bandes de B+H no apareix cap banda de 0.5 (2.7-2.2). Podríem provar amb l’ordre de 2.5 i 1 canviats → 2.4 - 1.0 - 2.7 - 2.5, però veuríem que el patró de bandes de H+B no ens quadraria.
Quan ja coneixem la posició de cada fragment, posem els tres enzims junts i ens surt el seguent mapa de restricció. (lo que està dins el requadre taronja és la resposta).
18 Problemes biologia molecular - Sònia Vivo 25. El DNA del plasmidi pHUB1 és circular, de doble cadena i conté 5,7 Kpb. Aquest plasmidi porta un gen de resistència a tetraciclina (TetR) i presenta un sol punt de tall pels següents enzims de restricció: EcoRI, HpaI, BamHI, PstI, SalI i BglII. Si es clona en els llocs BamHI i SalI es perd la resistència a tetraciclina. Si es clona en els altres llocs aquesta resistència no es perd. La digestió amb els enzims de digestió esmentats i diferents combinacions d’ells dóna fragments de DNA de les mides indicades a la taula. Posiciona els llocs de restricció per tots els enzims en un mapa de restricció.
26. Es tracta un plasmidi KanR AmpR amb l’enzim BglII que té una diana en el gen de resistència a ampicil·lina. A continuació es barreja el plasmidi amb els productes de digestió del DNA de Drosophila melanogaster també tallat amb BglII, es lliga amb T4 DNA lligasa i es transformen cèl·lules d’E. coli.
a. Quin antibiòtic afegiríeu a la placa 19 Problemes biologia molecular - Sònia Vivo per seleccionar les colònies que han incorporat un plasmidi recombinant? Kan. Alguns dels plasmidis hauran incorporat el producte de digestió de Drosophila melanogaster i altres no, però totes les cèl·lules que hagin incorporat el plasmidi tindran el gen Kan intacte.
b. Quins fenotips de resistència a antibiòtic es trobaran a la placa? Hi hauran els fenotips KanR i AmpR (s’anomenen clons relligats, no han incorporat el fragment de Drosophila) i el fenotip KanR i AmpS (han incorporat el fragment de Drosophila i, per tant, s’han tornat sensibles a l’ampicilina). Hi han dues poblacions de cèl·lules diferents.
c. Quin fenotip tindran els plasmidis que hagin incorporat el DNA de Drosophila melanogaster? KanR i AmpS.
27. Una investigadora genera una llibreria de plasmidis que contenen inserts de 10-15 Kpb provinents del genoma d’un bacteri obtinguts mitjançant digestió parcial amb EcoRI i clonatge dels fragments resultants en el lloc EcoRI d’un plasmidi. La investigadora ha d’identificar els plasmidis que contenen el gen purB. Per fer això, 5 dels plasmidis de la llibreria es digereixen totalment amb EcoRI i les digestions s’analitzen per electroforesi en un gel d’agarosa (Figura 1). En un segon experiment (Figura 2), els mateixos 5 plasmidis s’analitzen per PCR utilitzant primers o encebadors derivats de seqüències internes de purB, i els productes de l’amplificació s’analitzen novament per electroforesi en gel d’agarosa. Ambdós gels es van tenyir amb bromur d’etidi per tal de visualitzar el DNA.
a. De les següents parelles, quines poden tenir fragments que se sobreposin (overlapping sequences)? 1. Només 3 i 4 2. Només 3 i 5 3. 1 amb 2 i 3 amb 4 4. 1 amb 3 i 2 amb 5 (ja que la banda a 5kb no es té en compte ja que és el vector → ho tenen tots).
5. Tots els inserts es poden sobreposar 20 Problemes biologia molecular - Sònia Vivo b. Quin dels següents mètodes NO seria una alternativa útil a la PCR per determinar els plasmidis que contenen el gen purB? 1. Fer assajos de complementació en soques auxotròfiques per purB.
2. Seqüenciar els inserts.
3. Hibridar els plasmidis en un experiment Southern amb una sonda complementària a purB.
(Es pot utilitzar però no asseguren que hi hagi tot el gen) 4. Fer un mapa de restricció amb diferents endonucleases de restricció. (sí es pot utilitzar però abans s’ha de saber el mapa de restricció).
5. Fer un experiment de footprinting amb una DNA nucleasa. → El footprint serveix per conèixer quina seqüència reconeix una proteïna. Al afegir la proteïna aquesta s’uneix al DNA.
Posteriorment s’afegeix endonucleasa la qual degrada tot el DNA excepte el que es troba protegit per la proteïna. Finalment, la proteïna allibera el fragment de DNA i podem mirar quina és aquesta seqüència.
c. La regió de purB complementària als primers utilitzats en la PCR es troba en els següents plasmidis: 1. Només en el plasmidi 2 2. Només en el plasmidi 5 3. Tant en el plasmidi 2 com en el 5 (mirar gel 2 per saber la resposta).
4. En els plasmidis 1, 3 i 4 5. En tots 5 plasmidis 21 ...