TEMA 3. ORGANITZACIÓ DEL GENOMA EUCARIÒTIC (2014)

Apunte Catalán
Universidad Universidad Autónoma de Barcelona (UAB)
Grado Genética - 2º curso
Asignatura Biologia Molecular d'Eucariotes
Año del apunte 2014
Páginas 16
Fecha de subida 22/10/2014
Descargas 32
Subido por

Vista previa del texto

TEMA 3: ORGANITZACIÓ DEL GENOMA EUCARIÒTIC Dins el grup dels organismes eucariotes, hi ha una gran diversitat pel que fa a la mida del seu genoma. S’ha intentat explicar el fet que hi hagi organismes amb un genoma molt més gran que uns altres, i que en general aquesta hagi estat la tendència durant l’evolució (per exemple, perquè d’aquesta manera s’evita que les mutacions afectin tant), però no s’ha arribat a cap conclusió satisfactòria, ja que la mida del genoma no està relacionada amb la complexitat de l’organisme. En el següent exemple podem veure la comparació entre diferents grups d’organismes, i com realment organismes menys complexos que altres tenen un genoma molt més gran.
El que sí que se sap és com evolucionen els genomes: per què creixen, per què canvien... Els genomes van patint inversions, translocacions, fusions de cromosomes, duplicacions de regions, fins i tot duplicacions del genoma complet... I també hi ha transposicions de zones, augment de les còpies repetitives... Tot això fa que els genomes evolucionin.
Actualment el genoma més gran conegut és el d’una planta, que té moltes seqüències repetitives (ja vam veure que com més gran és el genoma, menys tant per cent de gens hi ha en relació a la llargada d’aquest, i més seqüències repetitives trobem).
Entre totes les seqüències repetitives que pot tenir un organisme en el seu genoma, n’hi pot haver algunes que escapin als controls cel·lulars. De fet, s’han descobert elements transposables relacionats amb el càncer, l’hemofília...
El genoma està format per petits trossets que es van solapant, ja que els extrems de les seqüències coincideixen. Però això no es pot aplicar als elements transposables.
Els pseudogens són gens inactius. Normalment procedeixen de la duplicació d’un gen. El gen nou acumula una sèrie de mutacions i es torna inactiu, de manera que al genoma tenir el primer gen, que codifica per un RNA funcional, i el pseudogèn que està inactiu. Es diu pseudogèn perquè si analitzem la seqüència veiem que té homologia amb el gen original del qual ha estat copiat, i només hi ha unes poques bases de diferència. Aquestes poques bases són mutacions que ja fan que no sigui funcional, o també pot ser que codifiquin per un codó stop al mig de la seqüència, que no tingui promotors...
Els fragments de gens apareixen a causa de duplicacions de gen interrompudes. Les RNT són Regions No Traduïdes (introns).
El DNA intergènic està format per regions que no es troben en un cromosoma determinat, sinó que es poden trobar en qualsevol lloc.
Els elements transposables són un grup de quatre tipus: els LINE, els elements LTR, els SINE i els transposons. Uns dels altres es diferencien per l’estructura o pel mètode a l’hora de transposar.
Els LINE transposen mitjançant un RNA intermediari. La seqüència del LINE es transcriu a RNA, i després aquest es retrotranscriu, gràcies a una retrotranscriptasa inversa. La nova seqüència LINE s’insereix en un altre lloc del DNA.
Els elements LTR tenen un mètode de replicació igual que les seqüències LINE: es copien per un intermediari de RNA i la retrotranscriptasa inversa, i després s’insereixen en una altra zona. La diferència rau en l’estructura. Els LTR tenen LTRs (Long Terminal Repeat). Les LTR són seqüències terminals repetides, se’n troben dues, una a cada extrem de l’element LTR. Les dues seqüències són exactament iguals: GTCATTCGTAGCTAGCTTAGCGGACT ------ element LTR ------ GTCATTCGTAGCTAGCTTAGCGGACT LTR LTR Com més semblants són els dos extrems LTR vol dir que més recent és l’element LTR, ja que amb el temps van acumulant mutacions que els diferencien. Si els dos extrems són iguals, vol dir que aquest element s’acaba de transposar. D’aquesta manera podem saber l’edat de l’element.
Els SINE són com els LINE però en comptes de ser llargs són curts (L de long i S de small). Són com elements LINE degenerats, els falta una part de l’estructura. Com procedeixen dels LINE, o almenys hi tenen una gran homologia, poden beneficiar-se de les proteïnes que fan servir aquests per la transposició, i fer-les servir també ells. De fet els SINE són les seqüències més abundants en el nostre genoma. Dins d’aquest grup també hi ha diferents tipus, i les més abundants de totes són les seqüències ALU.
Els transposons són l’únic tipus dels elements transposables que no té intermediari de RNA, per això es diuen transposons de DNA. El seu mètode de transposició és escindir-se de la regió on són i inserir-se ells mateixos en un altre lloc del genoma. Tot i que en el mètode de transposició no es fa cap còpia, els transposons es troben repetits al genoma perquè al moure’s, un transposó deixa un lloc buit, com un forat. Aquest forat ha de ser tapat, i llavors la maquinària de reparació cel·lular utilitza com a motlle el cromosoma homòleg (que té el mateix transposó, però aquest no s’ha mogut) per crear una seqüència de DNA per omplir-lo. D’aquesta manera es crea un nou transposó, igual que l’altre. No obstant, no hi ha tantes còpies de transposons al genoma com d’elements LTR.
Tm: UN REFLEX DE LA COMPOSICIÓ PROMIG DE LA COMPOSICIÓ D’UN ADN S’analitza amb espectroscòpia, i depèn del contingut en G-C. Aquest gràfic és una corba de fusió. Les corbes de fusió s’obtenen en mesurar l’absorbància d’una molècula de DNA sotmès a calor. La calor es va augmentant progressivament, i les dues cadenes de DNA es van separant, fins que s’arriba una temperatura en la que se separen completament.
El DNA absorbeix a una longitud d’ona de 290 nm, i té major absorbància com més separades estan les dues cadenes. Al punt d’inflexió de la corba, la meitat del DNA es troba en forma de cadena simple, i l’altra meitat continua en doble cadena. Aquest punt és el Tm, la temperatura de dissociació.
Si comparem corbes de diferents organismes podem veure la complexitat en contingut de G-C. Aquestes dues bases estan unides per tres ponts d’hidrogen, per tant estan unides més fortament que l’A-T. Per tant, com més G-C hi hagi, més costarà separar les dues cadenes, és a dir, es necessitarà més calor, per tant la Tm serà més alta. Com sabem que les regions gèniques normalment tenen un contingut en G-C més alt, com més alta tingui un organisme la Tm, més gens tindrà.
Aquest gràfic s’anomena corba COT (Co x T = concentració inicial per temps).
Aquesta corba fa referència a la velocitat de renaturalització. Es disminueix progressivament la temperatura i es veu quant de temps triguen a reassociar-se les dues cadenes.
Un organisme pot tenir gens que siguin una única còpia, seqüències mitjanament repetitives (elements transposables) i seqüències altament repetitives. Com més repetitiva és una seqüència menys triga a renaturalitzar-se. Per tant els gens són els que triguen més a reassociar-se, necessiten que la temperatura disminueixi més.
DNA REPETITIU El DNA altament repetitiu són formar part dels telòmers. El DNA mitjanament repetitiu és on trobem els elements transposables (Sine o Line sobretot). Les seqüències repetitives en tàndem es troben sobretot en zones properes a centròmers i en zones d’heterocromatina.
ESTRUCTURA D’UN GEN EUCARIOTA Corriente-arriba = up-stream.
Corriente-abajo = down-stream.
Les regions promotores formen part del gen però no es transcriuen, perquè són seqüències de reconeixement de la RNA-polimerasa. Aquestes regions tenen una distància fixa respecte tots els gens. Són regions molt conservades. Les dues caixes que formen la regió promotora es diuen CCAAT i TATA perquè aquestes són les seqüències repetides que tenen.
La unitat transcripcional està formada per introns, exons i regions no codificants (UTRs).
El potenciador (enhancer) està format per unes seqüències que estan a molta distància del gen (a més, aquesta distància és variable, no com les regions promotores), fins i tot pot estar a Kb de distància. S’uneixen a proteïnes que fan que el DNA es plegui i llavors els potenciadors s’acosti més al gen. Com bé indicia el seu nom, el que fan és augmentar la transcripció.
Ex: gen de la α-tropomiosina. Aquest gen codifica per una proteïna que es troba en tots els músculs del cos. Però com podem veure a la imatge, el gen codifica per diferents tipus de tropomiosines a la vegada, que són específiques de cada tipus de múscul.
El color rosa són els exons constitutius. Es diuen així perquè estan presents en tots els transcrits (excepte un que és un cas especial de càncer  hepatoma). Hi ha altres exons que pot ser que es transcriguin o no, i segons això ens trobarem en un tipus de múscul o un altre.
GENS COMPOSTOS PER PARTS D’ALTRES GENS Això es pot explicar fàcilment amb l’exemple del gen del receptor de l’LDL. Aquest és un gen molt gran amb gran quantitat d’exons. Les parts blanques representen els introns, i les de color són els exons.
El gen del receptor de l’LDL és molt gran. La zona entre els exons 6 i 14 presenta homologia amb un gen de creixement epidèrmic. Dels exons 1 al 5 presenta homologia amb un altre gen.
Aquests gens no tenen perquè coincidir exactament amb la disposició d’introns i exons del gen del receptor de l’LDL.
No és casualitat que aquests gens s’assemblin, sinó que és conseqüència de que evolutivament s’han anat fent còpies, duplicacions, remodelacions, canvis... De manera que una part d’un gen pot acabar duplicant-se, movent-se de lloc i modificant-se una mica, com és el cas del gen del receptor de l’LDL.
EXEMPLES DE GENS QUE CONTENEN ALTRES GENS SnoRNA Els seus introns són gens de RNAs petits nuclears.
Gen de NF1 El gen de la neurobromina és un gen supervisor tumoral (supervisa que no es creïn tumors). Dins d’un dels introns, concretament el 27, aquest es transcriu i dóna lloc a dos RNAs. Un RNA per cada cadena de l’intró, així que es creen dues proteïnes. Aquestes tenen una funció molt lligada a la neurofibromina.
Gen del factor VIII Aquest gen té un intró que actua com a exó d’uns altres dos gens, ja que es transcriuen les seves dues cadenes, de manera que es formen dues proteïnes. Les proteïnes codificades per aquest intró no tenen res a veure amb la coagulació sanguínia (com el factor VIII). Per tant és totalment diferent que el cas anterior, en que les proteïnes codificades per l’intró estaven realcionades amb la neurfibromina.
Gen RB1 El gen del retinoblastoma és un gen supressor tumoral, controla el creixement cel·lular. Un dels seus introns actua com a exó d’un altre gen. L’exó d’aquest gen en realitat es transcriu en direcció contrària de la que ho fa el gen del retinoblastoma.
GENOMA HUMÀ DNA ALTAMENT REPETITIU DNA FINGERPRINTING Les seqüències de DNA repetitiu poden trobar-se en el genoma n vegades. Els microsatèl·lits normalment no estan dins dels gens, així que són més fàcils de trobar. Llavors per a què s’utilitzen si són seqüències que no codifiquen per res? Permeten la identificació d’individus en medicina forense.
S’utilitzen primers (encebadors) que marquen les regions on es troben els microsatèl·lits, i llavors aquests es poden amplificar mitjançant PCR. Després es fa una electroforesi, de manera que queden unes bandes o unes altres segons les repeticions de microsatèl·lits que es tenen al genoma. És quasi impossible que dos individus tinguin el mateix patró de bandes fingerprinting.
Normalment s’utilitzen de 12 a 15 marcadors de microsatèl·lit.
En aquest exemple hi ha 6 marcadors: La nena 2 és fruit d’una nit de juerga lokissima en que la mare es va desmadrar una mica massa i va acabar buscant pollitas per on fos. El pare no en sap res. El nen 2 és un nen rus adoptat, que no ho sap i tenen por de dir-li perquè sospiten que els vol matar a tots.
Exemple de com es faria la prova del DNA fingerprinting: sabem que en una parella de cromosomes homòlegs hi pot haver dos possibles seqüència de microsatèl·lits, cada una amb un nombre de repeticions diferents. La part vermella dels extrems són les seqüències on s’uneixen els primers, que són iguals per un microsatèl·lit o l’altre. Les dues seqüències poden ser amplificades, i òbviament la B correrà menys al gel d’electroforesi, perquè és més gran. Fent el fingerprinting aquests serien els possibles resultats.
RECOMBINACIÓ ECTÒPICA La recombinació ectòpica provoca el canvi del nombre de seqüències repetitives en zones on trobem DNA repetitiu. A aquesta recombinació també se l’ha pot anomenar recombinació desigual o al·lèlica.
Les seqüències repetitives, a vegades, justament a causa de la seva naturalesa repetitiva, es troben desplaçades l’una de l’altre en cromosomes homòlegs. Llavors durant la meiosi hi ha una recombinació ectòpica: la recombinació es pot donar perquè al ser repetitives, les seqüències tenen homologia tot i estar desplaçades.
Però llavors es creen gàmetes diferents.
També hi pot haver canvis en el nombre de repeticions durant la replicació per errors en la DNApolimerasa. Això s’anomena “replication slippage”. La DNA-polimerasa va copiant la cadena fins que arriba a una zona repetitiva, on pot ser que “es liï”, i repliqui dos cops una mateixa repetició, o se’n deixi una. Llavor, en la següent replicació, una de les seqüències tindrà una repetició més o menys que l’original.
Les conseqüències funcionals del “replication slippage” són: - En regions no codificants: canvis en la mida del cromosoma.
En regions codificants: canvis en l’estructura i mida de la proteïna. Ex: malaltia de Huntington. Dins el gen d’una proteïna hi ha dos codons iguals. Les repeticions van augmentant a causa del “replication slippage”, fins que s’arriba a tenir un nombre de codons que fa que la proteïna no sigui funcional, i llavors es desenvolupa la malaltia.
SNPs Les SNPs són variacions d’un sol nucleòtid que provoquen un nou fenotip (Single Nucleotid Polymorphism). Quan parlem de SNPs, no parlem d’al·lels, sinó d’haplotips. La idea és associar un SNP a una manifestació fenotípica (una malaltia, una resposta a un fàrmac...).
El genoma humà té uns 3 milions de SNPs repartits de manera aleatòria.
Ex: un SNP determina la resposta al tractament d’un fàrmac.
Hi ha un projecte anomenat HapMap (Mapa dels Haplotips) que té l’objectiu d’identificar els patrons més comuns de variació de la seqüència de DNA humà en diferents poblacions del planeta i facilitar la localització de gens relacionats amb malalties.
DNA MITJANAMENT REPETITIU MÉS ABUNDANT AL GENOMA HUMÀ - SINE(s): elements nuclears curts i dispersos. Dins aquest grup els més abundants són els “al”.
LINE(s): elements nuclears llargs i dispersos.
HERV: retrovirus endògens humans. Provenen d’infeccions víriques molt antigues en l’evolució que es van quedar al genoma i s’han transmès. Funcionen com un retrotransposó. A part de la transmissió vertical (transmetre’s de generació en generació) també pot fer transmissió horitzontal (dins la primera cèl·lula es creen les proteïnes de al càpsida, es forma el virus i aquest surt de la cèl·lula per infectar una altra). Però aquests retrovirus han patit moltes modificacions al llarg de l’evolució, i ara generalment ja no són actius transcripcionalment. No obstant n’hi ha alguns que sí que ho són i pràcticament es consideren gens (ex: hi ha uns que participen en la formació de la placenta). Els retrovirus representen més del 5% del genoma humà.
Si estudiem un segment del genoma humà podem veure aquesta abundància de cada tipus. Els LTR, els propis transposons, no són especialment abundants en humans. Ho són molt més els retrovirus endògens (que són LTRs, però procedents d’un virus).
CATEGORIES DELS GENS HUMANS Aquest diagrama es refereix a les funcions que fan les proteïnes (o RNAs) per les quals codifiquen els gens. Per exemple parlem de les proteïnes involucrades en la transducció de senyals a la cèl·lula, o dels enzims que formen part de totes les rutes bioquímiques.
ORIGEN DE NOUS GENS PER REPLICACIÓ Al genoma, durant l’evolució, hi ha hagut duplicació gènica, així que alguns gens es troben duplicats. Aquestes duplicacions donen lloc a les famílies multigèniques: són gens que codifiquen per la mateixa proteïna o per proteïnes molt semblants (tenen la mateixa funció però una és específica per un estadi de desenvolupament, una per un altre...).
Com es produeix una duplicació gènica? A través de diversos mecanismes: - Recombinació ectòpica: recombinació entre seqüències homòlogues però desplaçades, que es troben en cromosomes diferents o en punts diferents d’un mateix cromosoma.
(dibuix paper).
- Si un ET (Element Tranposable) es transcriu a RNA per moure’s, i aquesta transcripció no acaba quan hauria d’acabar i continua, pot ser que es transcrigui també un gen proper a l’ET, de manera que se n’acabi fent una còpia en una altra banda.
La segona còpia del gen pot acumular mutacions i deixar de ser actiu. Llavors tindríem un gen actiu i un pseudogèn (gen inactiu). Quan seqüenciem el pseudogèn veiem que és una còpia perquè té homologia amb el primer gen. A aquest procés se l’anomena nonfuncionalització.
També pot ser que les dues còpies del gen evolucionin de manera diferent. La segona còpia pot ser que tingui una mutació que faci que continuï sent funcional, però que ara codifiqui per una proteïna diferent que no tingui relació amb la funció del gen original. Aquest és el cas de la neofuncionalització.
Un altre cas és el de la subfuncionalització. En aquest cas la còpia del gen i l’original van acumulant petits canvis i això fa que acabin codificant per proteïnes lleugerament diferents amb funcions relacionades. Normalment són proteïnes que fan la mateixa funció però en moments diferents del cicle cel·lular, en condicions diferents...
La robustesa genètica és un fet que ocorre quan el gen ancestral té una duplicació i es mantenen les dues còpies del gen intactes. Llavors, tindrem una producció de proteïna major.
Exemple de subfuncionalització: família multigènica de les globines Tots els tipus de globines estan relacionades d’alguna manera amb l’oxigen. En el gràfic següent podem veure com diferents tipus actuen en els diferents estadis de l’embrió i de la vida, i com això fa que la proporció de síntesi de cada una vagi variant. La γ disminueix després de néixer perquè només és embrionària, mentre que la β, després del naixement, augmenta. La globina γ és molt necessària en l’etapa embrionària per agafar l’oxigen de la mare, ja que té molta afinitat amb aquesta molècula.
Evolució dels gens de les globines a partir de duplicacions gèniques successives: En un primer moment es va duplicar el gen ancestral, i les dues còpies resultants van anar augmentant els canvis i mutacions. Això va fer que es creessin dues famílies gèniques. Un d’aquests gens va patir una altra duplicació i va donar lloc a dos gens: al cromosoma 11 hi ha les cadenes de la β-globina, i al cromosoma 16 hi ha les α. Les còpies que tenen la lletra Ѱ són inactives (són pseudogens). Això significa que al llarg de l’evolució, algunes de les mutacions que han acumulat les còpies dels gens han fet que s’inactivessin. Tant el gen de la α com de la β van donar lloc a pseudogens. Finalment, l’altre dels gens de la primera duplicació, al cromosoma 22, va donar lloc a la mioglobina.
Exemple de subfuncionalització Aquest cas explica com es va arribar a la visió tricromàtica en els primats. Els primats tenen aquest nivell de visió perquè són capaços de sintetitzar opsines. Gràcies a les opsines l’ull pot captar unes certes longituds d’ones.
Quan el gen SGRC es va duplicar, va anar patint modificacions en la línia evolutiva de formació dels primats. Era un gen relacionat amb les connexions neuronals. En mutar, va crear més relacions neuronals pel sentit de la vista, aconseguint així la visió tricromàtica.
DOS GENS RELACIONATS EVOLUCIONEN CAP A FUNCIONS DIFERENTS El gen ancestral era el gen que codificava per la lisozima, un enzim capaç de degradar la paret bacteriana. Quan es van separar filogenèticament les aus i els mamífers, en els primers aquest gen no va evolucionar gens, i en comptes en els segons sí. En els mamífers les mutacions van fer que acabes codificant per la lactoalbúmina, que és l’albúmina de la llet. Per això les femelles de mamífers poden produir llet materna i les aus no.
Al final, per tant, aquests dos gens s’assemblen en les seqüències però no en la funció.
GENS HOMÒLEGS/ORTÒLEGS/PARÀLEGS El gen A és un gen ortòleg entre les diferents espècies, que vol dir que té un gen homòleg en una altra espècie, és a dir, que fa la mateixa funció. Els dos gens poden ser lleugerament diferents en la seqüència de nucleòtids.
Els gens són paràlegs quan provenen d’un mateix gen que s’ha duplicat però un d’ells, o els dos, han mutat i tenen funcions diferents (és el cas de B i A). Només podem parlar de gens paràlegs dins una mateixa espècie.
Per tant dins els gens homòlegs hi ha els ortòlegs i el paràlegs. Amb homòlegs simplement ens estem referint a la semblança en la seqüència de nucleòtids, però no sabem la funció ORIGEN DELS PSEUDOGENS Alguns pseudogens es formen a través de la transcripció inversa. En determinades situacions, en el genoma hi ha disponible transcriptasa inversa, provinent d’alguna infecció vírica o un element transposable. Qualsevol gen funcional pot ser traduït a mRNA. Aquesta transcriptasa inversa passa l’RNA a DNA. Llavors aquest DNA es pot inserta en algun lloc del genoma i donar lloc a una duplicació del primer gen, però com aquesta còpia no té promotors, en aquest cas el gen no serà funcional.
Sí que ens podem trobar en el cas de que la còpia s’insereixi en una regió on hi hagi un promotor a prop que li pugui servir; llavors no parlem d’un pseudogèn perquè la còpia es pot expressar i ser funcional.
DISTRIBUCIÓ DELS GENS HUMANS EN ALTRES ESPÈCIES En aquest cas estaríem parlant de gens ortòlegs.
ANÀLISI DE L’EXPRESSIÓ DELS GENS Aquest assaig permet veure els gens que estan actius i s’expressen i els que estan inactius.
Els microarrays són matrius sòlides, plaques que tenen com unes caselles on es localitzen els cDNAs de diferents gens. Cada casella correspon a un gen.
De cada mostra (sans i malalts) el mRNA es passa a cDNA per retranscripció in vitro.
Com en els microarrays cada casella correspon a un gen, si la mostra que se li afegeix també té aquell gen, hibridaran. El cDNA dels malalts està marcat amb fluorocroms de color vermell, i el cDNA dels sans està marcat amb fluorocroms de color verd.
Si una casella és de color verd, voldrà dir que aquell gen s’expressa en els sang, si és de color vermell que s’expressa en els malalts, i si és de color groc que s’expressa en els dos.
...