Exercici entregable BIOEDIT (BIA) (Part genètica) (2017)

Trabajo Catalán
Universidad Universidad de Girona (UdG)
Grado Biología - 3º curso
Asignatura Bioinformàtica Aplicada
Año del apunte 2017
Páginas 4
Fecha de subida 01/07/2017
Descargas 0
Subido por

Descripción

Inclou l'exercici entregable corresponent a la sessió de BIOEDIT de la part genètica de l'assignatura de Bioinformàtica Aplicada (BIA) (Part genètica)

Vista previa del texto

3r Biologia – UdG Natalia Mingorance García UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA EXERCICI BIOEDIT Nom i Cognoms: Natalia Mingorance García Grup: 5 3r Biologia – UdG Natalia Mingorance García UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA Descarrega des de NCBI (http://www.ncbi.nlm.nih.gov/) la seqüència amb número d’accés AY955198 amb un arxiu que tingui format GenBank full (.gb). Anomena el teu arxiu com a “Mostra_A” i desa’l.
1. Quina és l’anotació d’aquesta seqüència? Quin tipus de molècula estàs analitzant? Quina és la seva longitud? Chelonia mydas haplotype J1 control region, partial sequence; mitochondrial Tipus de molècula: DNA genòmic Longitud: 384 parells de bases Al Moodle trobaràs un arxiu en format GENBANK anomenat “tortuga.gb”. Obre el programa BioEdit i carrega l’arxiu.
2. Quantes seqüències hi ha a l’arxiu? Hi ha 5 seqüències a l’arxiu.
Renombra les seqüències únicament amb el nom de l’haplotip (per exemple, B5). Obre l’arxiu “Mostra_A” amb BioEdit i enganxa la seqüència a l’arxiu “tortuga.gb”.
3. Indica quina ruta de comandes utilitzes.
Bioedit > file > open > Mostra_A.gb Seleccionem la seqüència que ens interessa > Edit > Copy sequence(s) Un cop a l’arxiu “tortuga.gb” Edit > Paste sequence(s) 4. Quina és la longitud de les diferents seqüències incloses? B5 --> 385 pb E2 --> 394 pb E1 --> 394 pb A3 --> 384 pb A2 --> 384 pb J1 --> 384 pb Realitza l’alineament múltiple de les teves seqüències utilitzant el programa ClustalW.
1 3r Biologia – UdG Natalia Mingorance García UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA 5. Quina ruta de comandes utilitzes? Edit > select all > Accessory Application > ClustalW Multiple Alignment 6. Quina és la Length i True Length de les seqüències alineades? Seqüència alineada B5 E2 E1 A3 A2 J1 Length 395 395 395 395 395 395 True Length 385 394 394 384 384 384 7. Quina és la composició nucleotídica (G+C content) de cadascuna de les seqüències? Indica la ruta utilitzada per aconseguir aquests resultats.
Seleccionar la seqüència d’interès > Sequence > Nucleic Acid > Nucleotide Composition DNA molecule: B5 G+C content = 30,91% DNA molecule: E2 G+C content = 31,47% DNA molecule: E1 G+C content = 31,73% DNA molecule: A3 G+C content = 31,25% DNA molecule: A2 G+C content = 31,51% DNA molecule: J1 G+C content = 31,51% Calcula la matriu d’identitat entre les diferents seqüències.
Sequence Difference Count Matrix Seq-> B5 E2 E1 A3 A2 J1 B5 ID 25 26 14 15 13 E2 25 ID 1 11 14 30 E1 26 1 ID 12 15 31 A3 14 11 12 ID 3 21 A2 15 14 15 3 ID 20 J1 13 30 31 21 20 ID 2 3r Biologia – UdG Natalia Mingorance García UNYBOOK: nattymg23 BIOINFORMÀTICA APLICADA 8. Quin parell o parells de seqüències són les més semblants? I quines són les més diferents? Inclou la matriu d’identitat en Excel per tal que la matriu quedi ben alineada.
El parell de sequències més semblants són E2 i E1.
Les més diferents són J1 i E1.
Crea una seqüència consens a partir de les seqüències alineades.
9. Copia i enganxa la seqüència consens.
>Consensus TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATRAAAATT ATTRARTTYRCATAAAAYATTTTAATRRCATGAATATTAAGCAGAGARTTAA AAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAAT ATTGTCACRGTAATTGGTTATTTCYTAAATAGCTATTCACGAGAAATAAGCA ACCCTTGTTAGTAAGATACAACATTACCAGTTTCARGCCCATTCARTTTGTG RCGTACATAAYYTGATCTATTCTGGCCTCTGGTTGTTYYTTCAGGCACATAY AAATARYRACGTTCATTCGTTCCYCTTTAAAAGGCCTTTGGTTGCCTTTGGTT GRATGAGTTCTATACATTARATTTATAACCT 10. Fes un BLAST per cadascuna de les seqüències i indica quina és la seva anotació i el número d’identificació GenBank de la seqüència amb la que tingui una homologia més elevada sobre la base de dades “Nucleotide collection (nr/nt)”.
B5 --> Chelonia mydas isolate CmP82.1 tRNA-Pro gene and D-loop, partial sequence; mitochondrial (KJ502584.1) E2 --> Chelonia mydas isolate CmP61.1 tRNA-Pro gene and D-loop, partial sequence; mitochondrial (KJ502592.1) E1 --> Chelonia mydas haplotype E1 control region, partial sequence; mitochondrial (AY955217.1) A3 --> Chelonia mydas voucher T 140 D-loop, partial sequence; mitochondrial (KM357658.1) A2 --> Chelonia mydas isolate CmP47.4 tRNA-Pro gene and D-loop, partial sequence; mitochondrial (KJ502632.1) J1 --> Chelonia mydas haplotype J1 control region, partial sequence; mitochondrial (AY955198.1) 3 ...

Tags:
Comprar Previsualizar