Resumen genética T5 a T10 (2017)

Resumen Español
Universidad Universidad Autónoma de Barcelona (UAB)
Grado Biología Ambiental - 1º curso
Asignatura Genética
Profesor P.G.
Año del apunte 2017
Páginas 35
Fecha de subida 22/10/2017
Descargas 0
Subido por

Descripción

Resumen segundo parcial genética, falta el T7

Vista previa del texto

Ariadna Fernández Vilert TEMA 5 Ligamiento: fundamentos de la cartografía cromosómica en eucariotas - Se dice que dos loci están ligados cuando se encuentran situados sobre el mismo cromosoma y se transmiten juntos a una frecuencia mayor a la esperada por azar.
- Los genes de un mismo cromosoma pertenecen al mismo grupo de ligamiento.
COMBINACIONES ESPERADAS POR SEGREGACIÓN INDEPENDIENTE Genes completamente ligados: son los tipos parentales: Encontramos dos tipos de configuración de los alelos ligados dentro del cromosoma: 1 - Repulsión o TRANS Ab/aB - Acoplamiento CIS AB/ab Ariadna Fernández Vilert La recombinación es un proceso meiótico que genera un producto haploide cuyo genotipo difiere de los dos genotipos haploides que constituían el diploide meiótico.
La evidencia citológica del entrecruzamiento son los quiasmas que se forman durante el apareamiento meiótico.
Combinaciones por entrecruzamiento de alelos localizados en un mismo cromosoma Frecuencia de recombinación (FR): FR= (número de recombinantes/número total de progenie )x100 FR=50% genes no ligados Si FR es significativamente <50% Hay LIGAMIENTO 2 Ariadna Fernández Vilert El Cruzamiento de prueba aclaró y confirmó el fenómeno de acoplamiento y Repulsión. Experimento: El % de recombinación entre dos genes es proporcional a la distancia entre ellos. Es decir, cuanto mayor es la distancia entre los genes mayor es la cantidad de entrecruzamientos que se pueden producir lo que implica mayor frecuencia de recombinación.
La fracción de recombinación varía entre 0 y 0.5 . Las distancias relativas entre genes, se determinan a partir los entrecruzamientos durante la meiosis.
Unidades de distancias genéticas utilizadas en la cartografía de genes Unidad de mapa genético = (m.u.) Unidad de mapa genético: distancia entre genes para la que uno de cada 100 productos meióticos resulta ser recombinante, o sea, una frecuencia de recombinación. (R.F.) de 0,01 ( 1% de recombinación) se define como 1 m.u. También conocida como 1 centimorgan (1 cM) Mapas genéticos: •La recombinación entre genes permite determinar las distancias físicas entre ellos.
•Los mapas genéticos o de ligamiento revelan el orden de los genes dentro de los cromosomas y la distancia aproximada entre genes sobre la base de las frecuencias de recombinación.
•Una unidad de mapa o centimorgan equivale a 1% de recombinación.
3 Ariadna Fernández Vilert Mapas genéticos: - Entrecruzamiento de dos puntos. Hacemos un cruzamiento de prueba con dos loci.
- Entrecruzamiento de tres puntos. Hacemos un cruzamiento de prueba con tres loci.
Mapa genético, marcadores. La mejor estima de la distancia entre los extremos es la suma a-b + b-c.
Coincidencia/ interferencia: •Coeficiente de coincidencia (CC) = número de entrecruzamientos dobles observados dividido entre el número de entrecruzamientos dobles esperados sobre las bases de las frecuencias de recombinación del entrecruzamiento simple.
o Si los múltiples entrecruzamientos suceden independientemente unos de otros, su frecuencia será al producto de la frecuencia de los intercambios sencillos.
•Coeficiente de interferencia (I): indica el grado en el que un entrecruzamiento interfiere en entrecruzamientos adicionales I=1 - CC Ejemplo: 4 Ariadna Fernández Vilert MAPAS GENÉTICOS VS MAPAS FÍSICOS Las unidades de un mapa genético no siempre se corresponden exactamente con las distancias físicas en el cromosoma debido a la existencia de factores que influyen sobre la recombinación (el sexo o el tipo de organismo…).
Tema 6: La mutación - De Vries: la mutación es cualquier cambio heredable en el material hereditario que no se puede explicar mediante segregación o recombinación. 1901 - A partir del conocimiento de la estructura del material hereditario (Watson y Crick, 1953) : la mutación es cualquier cambio en la secuencia de nucleotidos del DNA.
La mutación es la fuente primaria de variabilidad genética en las poblaciones, mientras que la recombinación al crear nuevas combinaciones a partir de las generadas por la mutación, es la fuente secundaria de variabilidad genética.
5 Ariadna Fernández Vilert Tasa de mutación: número de mutaciones por unidad de tiempo. Se expresa en número de mutaciones por gameto y generación, o por ronda de replicación.
Frecuencia de mutación: frecuencia con la que un tipo particular de mutación aparece en una población particular de células o de individuos.
Categorías de mutación (diapo esquema peixos): - Mutaciones en células somáticas: ocurren en células no sexuales. Y son pasadas a nuevas células a través de mitosis, creando un clon de células que contienen el gen mutante.
- “germ-line mutation”: ocurren en células que dan lugar a los gametos. La meiosis y la reproducción sexual permiten a las “germ-line mutations” ser pasadas a la mitad de los miembros de la siguiente generación, que llevaran la mutación en todas sus células.
Origen de las mutaciones: - Espontáneas: resultado de procesos biológicos o químicos que se producen en el organismo y alternan la estructura de las bases.
- Inducidas: Resultado de la actividad de agentes externos (mutágenos) tanto naturales (radiación UV) como artificiales (Rayos X, compuestos químicos).
Procesos que originan mutaciones espontáneas: - 6 Formas tautoméricas.
Ariadna Fernández Vilert - Despurinación y desaminación.
- Estrés oxidativo: oxidación de ciertas bases por la presencia de radicales que contienen oxígeno.
- Elementos transponibles: elementos del DNA que se pueden mover en el genoma.
Mutaciones inducidas químicamente: - Análogos de bases: 5-bromouracilo (5-BU), 2-aminopurina (2AP) - Agentes alquilantes: (MMS,EMS): donan grupos alquilo (CH3) a las bases nitrogenadas.
- Agentes que producen desaminación, hidroxilación: ácido nitroso e hidroxilamina.
- Reacciones oxidativas y agentes intercalantes Mutaciones originadas por agentes físicos (mutaciones físicas): - Radiaciones ionizantes: rayos X, gamma, neutrones. Generan radicales libres los cuales atacan el DNA, causan roturas de simple o doble cadena y alteraciones en los nucleótidos, producen roturas cromosómicas en células en división, por eso se usa en el tratamiento contra el cáncer (radioterapia).
- Radiaciones no ionizantes: luz ultravioleta. Produce dímeros de pirimidina intra e intercatenarios.
Mutaciones puntuales: Tipos de mutación en la región codificante de un gen 7 Ariadna Fernández Vilert Mutaciones indel y desplazamiento del marco de lectura Mutaciones puntuales: - Error en la replicación Anomalías cromosómicas Pueden ser: Estructurales (afectan a la estructura de los cromosomas, forma y tamaño): o Variación en el número de genes ▪ Deleciones: pérdida de genes ▪ Duplicaciones: aumento de genes o Variación en la disposición de los genes ▪ Inversiones: inversión de los genes ▪ Translocaciones: intercambio de genes entre cromosomas Numéricas (afectan al número de cromosomas): o Variación en el número de juegos cromosómico ▪ Haploidía: disminuye el número de juegos cromosómicos ▪ Poliploidía: aumenta el número de juegos cromosómicos o Variación en el número de cromosomas ▪ Aneuploidía: no hay un número exacto de juegos cromosómicos básicos.
Pérdidas o ganancías de uno, dos, tres o más cromosomas.
8 Ariadna Fernández Vilert INVERSIONES: cambio estructural por el cual un segmento cromosómico cambia de sentido dentro del propio cromosoma, y por lo tanto de los locis en él incluidos.
- Implican la rotura del cromosoma en dos puntos, denominados puntos de inversión.
Afectan el apareamiento durante meiosis. Pueden originar loops de inversión.
Aunque no se pierda material genético, si las roturas ocurren dentro de los genes pueden causar mutaciones.
Hay dos tipos de inversiones: - Inversión paracéntrica: reorganización de les genes NO implica el centrómero.
- Inversión pericéntrica: reorganización de los genes implica el centrómero.
El origen de las inversiones puede ser dado por una rotura y unión o por una recombinación ilegítima.
9 Ariadna Fernández Vilert Rotura y unión.
Recombinación ilegitima.
Importancia de las inversiones - Las inversiones inhiben la recombinación en los individuos heterocigotos - Las inversiones pueden mantener combinaciones génicas juntas que tienden a mantenerse constantes.
- Las inversiones solapantes permiten la construcción de árboles filogenéticos.
DELECIONES: pérdida de un segmento cromosómico, la mayoría de ellas son letales en homozigosis, las deleciones grandes pueden ser letales incluso en heterozigosis. Son importantes para relacionar grupos de ligamiento y su posición en los cromosomas.
2 tipos de deleciones: - Deleción terminal: se produce la pérdida de un segmento cromosómico del extremo.
- Deleción intersticial: la pérdida de un segmento cromosómico se produce en el medio del cromosoma Consecuencias de las delaciones: expresión de alelos recesivos, pseudodominancia y alelos haploinsuficientes (una sola copia del gen es insuficiente para producir un fenotipo de tipo salvaje.
Deleciones en humanos: 10 Ariadna Fernández Vilert DUPLICACIONES: incremento del número de copias de un segmento cromosómico.
Tipos de duplicaciones: - Duplicación en tándem: la región duplicada es adyacente a la región de origen. Puede ser tándem directo o inverso.
- Duplicación en localizaciones distantes: la región duplicada está desplazada de la región de origen.
TRANSLOCACIONES: son reordenamientos que involucran dos cromosomas no homólogos.
Tipos: 11 - Recíprocos: intercambio de segmentos entre 2 cromosomas no homólogos.
- Robertsonianos (céntricos): intercambios de brazos cromosómicos enteros, o fusión de cromosomas acrocéntricos.
Ariadna Fernández Vilert Las translocaciones pueden reducir la fertilidad debido a la producción de gametos no balanceados. Creación de nuevas relaciones de ligamiento.
AENUPLOIDÍA: cambio del número de cromosomas.
12 Ariadna Fernández Vilert Aneuploidías en humanos: - - 13 En autosomas: o Síndrome de Down-Trisomía cromosoma 21 o Síndrome de Edwards-Trisomía cromosoma 18 o Síndrome de Patau-trisomía cromosoma 13 o 15 En cromosomas sexuales: o Síndrome de Turner: cromosoma 45. X o Síndrome de Klinefelter: cromosoma 47. XXY o Hembra triple-X: cromosoma 47. XXX Ariadna Fernández Vilert POLIPLOIDÍA: 2 tipos - Autopoliploidía: dentro de la misma especie, no disyunción en la meiosis.
- Alopoliploidía: hibridación entre dos especies.
¿Cómo surgen los autopoliploides? Pueden surgir espontáneamente debido a la no-disyunción de un juego completo de cromosomas.
Los triploides normalmente surgen por cruzamiento entre diploides y tetraploides. 2Nx4N=3N.
La progenie es en general estéril, pero con importancia comercial (fruta sin semillas).
Los tetraploides pueden ser inducidos por tratamientos con colchicina.
TEMA 8: Función del DNA: La transcripción y la traducción La información genética inscrita en el ADN puede ser duplicada en más ADN, durante la replicación, o bien traducida a proteínas mediante dos procesos continuos la trascripción y la traducción.
LA TRANSCRIPCIÓN: proceso de síntesis de ARN.
El ARN se diferencia estructuralmente del ADN en el azúcar, que es la ribosa, y en una base, el uracilo, que reemplaza a la timina. Además, el ARN es una cadena sencilla.
14 Ariadna Fernández Vilert En todos los genes solo se transcribe una cadena de DNA.
EL ARN crece en sentido inverso s la cadena molde de DNA.
15 Ariadna Fernández Vilert El ARN (3’-5’) crece en sentido inverso a la cadena molde de DNA (5’-3’) TIPOS DE RNA: - mRNA: lleva la información de la secuencia de DNA a los ribosomas.
- tRNA: transporta los aminoácidos a los ribosomas - rRNA: forma parte estructural de los ribosomas RNA polimerasa en procariotas: - β (156 kDa) y β’(151kDa): subunidades catalíticas - α (dos subunidades idénticas) (37 kDa): Regula la frecuencia de iniciación - σ 70 (70 kDa): Interacciona con secuencias del promotor para determinar el sitio de inicio de la transcripción. Una vez iniciada se desprende del núcleo de la enzima.
Etapas del proceso de transcripción: Terminación de la transcripción: - Terminadores independientes de rho: Terminadores esenciales con una secuencia invertida repetida separada por 4 bases y que acaba en Timinas. Son capaces de formar estructuras de lazos por el apareamiento de bases complementarias.
Ej. AAAGGCTCCTTTTGGAGCCTTT 16 Ariadna Fernández Vilert - Terminadores dependientes de rho: Forman también estructuras en lazo, pero no poseen repeticiones terminales de T y dependen para la terminación de la proteína rho.
ESTRUCTURA DE UN GEN EUCARIOTA: - Unidad de transcripción: intrones, exones, regiones no codificantes (UTRs) - Elementos en cis: Promotores y potenciadores - TATA box (o Hogness box) en eucariotas se sitúa en minus 25. Región promotora - CCAAT box situado en minus 70.
TRANSCRIPCIÓN EN EUCARIOTAS: - Diferencias con procariotas: • 17 Se da en el núcleo.
Ariadna Fernández Vilert • No existe simultaneidad del proceso de transcripción-traducción. En procariotas hay simultaneidad en la transcripción y traducción, mientras que en eucariotas hay una compartimentación en el citoplasma y núcleo donde cada función se da en un lugar diferente.
• Hay modificaciones post-transcripcionales.
TRANSCRIPCIÓN EN EUCARIOTAS: Pasos: - En procariotas, la transcripción (RNA polimerasa2) se inicia por el factor sigma y los diferentes promotores y se termina con los terminadores.
- En eucariotas, funciona con los factores de transcripción (sin ellos no se puede dar a cabo la transcripción, tampoco se dará a cabo si el gen pierde el promotor).
o Reconocimiento del promotor. El TFII reconoce la caja TATTA, el factor TFII actúa como helicasa rompiendo los puentes de hidrogeno para transcribir una cadena.
La TFIID reconoce el 1r nucleótido que se va a transcribir.
o Las proteínas activadoras activan los enhancers que promueven y reconocen el plegamiento. RNA polimerasa no tiene capacidad correctora, DNA polimerasa sí.
Durante la transcripción actúan 3 tipos de polimerasa: ▪ RNA polimerasa 1: transcribe los genes de RNA ribosómico excepto el 5s ▪ RNA polimerasa 2: hace la mayor parte de la transcripción de los genes excepto los ribosómicos y de transferencia.
▪ RNA polimerasa 3: transcribe genes de RNA ribosómico 5s y el RNA de transferencia.
MODIFICACIONES DEL mRNA RNA mensajero nuclear heterogéneo (maduro) En eucariotas ocurre después o durante la transcripción: - Modificaciones en 5’ - Modificaciones en 3’ - Eliminaciones de los intrones (Splicing) CAP 5’: 18 • Al extremo 5´ se añade una caperuza (cap) mediante la adición de un nucleotido G metilado.
• La unión ocurre entre 5´ y 5´ (uno del RNA y el otro del 7- metil G) • Ocurre un poco después de la iniciación.
• Se cree que las enzimas necesarias están unidas a la RNA polimerasa II.
Ariadna Fernández Vilert IMPORTANCIA DE LA CAPERUZA 5’ • Juega un papel importante en la iniciación de la síntesis de proteínas.
• Protege el RNA en crecimiento de la degradación.
• Podría participar en el transporte del mRNA dentro o fuera del núcleo Extremo 3’: - Clivaje: entre 11 y 30 nucleótidos antes del clivaje, se corta el pre-mRNA de una secuencia consenso.
- Poliadenilación: adición de los nucleótidos de adenina, ocurre en el extremo 3’ del premRNA y genera la cola de poli (A).
IMPORTANCIA DE LA ADICIÓN DEL POLI-A • Colabora en la exportación de mRNA maduro desde el núcleo.
• Se cree que influye en la estabilidad de algunos mRNA.
• Parece servir de señal de reconocimiento para el ribosoma que se requiere para una traducción eficiente del mRNA.
• Junto con la caperuza de 5´permitirían a un ribosoma determinar si el RNA está intacto, antes de empezar su traducción.
Extremos 3’ y 5’ del RNA eucariótico Región líder: región de RNA que incluye 5’cap y AUG.
19 Ariadna Fernández Vilert AAUAA: secuencia consenso, entre 11-30 nucleótidos después se da el clivaje.
Región trailer (NO codificante): AAAAAAAA hasta el extremo 3’.
Esplaziozoma: serie de ribonucleoproteinas (formadas por RNA que permite unirse al RNA que van a cortar y por proteínas) que eliminan los intrones.
Hay intrones de genes que pueden eliminar los intrones sin necesidad del esplaziozoma ya que tienen el RNA capacidad autocatalítica. Se autoextinguen ellos mismos. Primero se extingue la región 5’, se pliega el intrón y se extingue la 3’.
SPLICING TRANSCRIPTASA INVERSA • DNA polimerasa dependiente de RNA • RNA pasa a ser DNA • El DNA es replicado para formar DNA de doble cadena • Degrada el RNA viral original (actividad Rnasa H) LA TRADUCCIÓN: 20 Ariadna Fernández Vilert Estructura típica de un tRNA, es importante que los tRNA que llevan los aminoácidos mantengan la estructura porque sino no podrán unirse a la zona del mRNA dentro del ribosoma.
Tienen esta estructura debido a las bases complementarias. Esta, es una estructura secundaria (el RNA es una cadena simple como estructura primaria) por eso se mantienen las bases de las zonas coloreadas, si hubiera cambios en estas bases, la estructura sería diferente y ya no podría transportar, si pudiera no podría colocarse en el mRNA dentro del ribosoma.
En el acceptor stern (ACC) es donde se une el aminoácido.
TyC loop: tiene una característica que lo diferencia de otros RNA y es que tiene bases no estándar como la y (psedouridina, base de uracilo modificada), esta base siempre está. El nombre de base que hay en TyC loop se mantiene, pero pueden cambiar (los que están en blanco sin letras).
D loop. Anticodon loop.
Variable loop: región más variable de los tRNA, siempre estará formado por 3-5 bases: lazo variable de tipo 1. Si tiene 7 bases es el lazo variable tipo 2.
INICIACIÓN EN PROCARIOTAS: 21 Ariadna Fernández Vilert Representación del ribosoma de eucariotas con 3 lugares importantes para la traducción: A: aminoacil P: peptidil E: exit (no realiza ninguna función, sino que es por donde se libera el tRNA) Para la síntesis de la proteína primero se necesita colocar un aminoácido, luego ya se añaden polipéptidos y al final sale (exit).
El inicio de la traducción en procariotas es que se desacoplen las dos subunidades del ribosoma, para eso se necesitan dos factores IF1 IF3, cuando estos se unen las dos subunidades se separan y se mantienen así, en cuando estos factores se vayan las subunidades se juntaran de nuevo.
El primer aminoácido que se une en procariotas es formilmeteonina, hace falta activarlo mediante la unión de una molécula de ATP aa+ATP = aa_AMP +pi Luego se tiene que unir el tRNA correspondiente al aminoácido. Esta unión se realiza por una enzima aminoacil sintetasa. A este complejo se le unirá otro factor IF2 y un GTP, a la vez ya llegando el mRNA. Se unirá el mRNA entrará (posicionando la región del codón de iniciación – AUG normalmente- en la región P del ribosoma y la región con la secuencia de shine-diagrano (presenta homología con el RNA ribosómico 5s) se unirá sobre E. De esta manera, se posiciona 22 Ariadna Fernández Vilert correctamente el RNA). Una vez posicionado el mRNA se unirá aa_tRNA a la subunidad pequeña (zona P) fijada por los dos factores.
ELONGACIÓN: EF-Tu + GTP hacen el posicionamiento en A del tRNA con n aminoácido nuevos, el GTP se hidroliza para que estos puedan pasar, luego se recuperará el GTP gracias a un factor EF-Ts. Una vez posicionados los dos mRNA con aa se forma el enlace peptídico con una peptidil transferasa (formilmetionina + alanina) de manera que queda el primer tRNA vacio, ahora hay que eliminarlo. Tenemos un RNA con dos aminoácidos y un RNAvacio (el1o), para que se elimine el tRNA vacío el ribosoma se va a desplazar (siempre de 3’ a 5’) pasando del sitio P a E por donde saldrá, de manera que el tRNA con aminoácidos pasa de A a P. A esto se le llama translocación, para esto interviene el factor EF-G (translocasa, es una enzima que permite el movimiento del ribosoma a lo largo del RNA mensajero) + GTP.
El hueco A está libre, esto se repite n-veces (tantas como tripletes de lectura tenga el mRNA, hasta que llegue a un codón stop).
23 Ariadna Fernández Vilert Terminación traducción: de la RF1: UAA/UAG codón de iniciación - RF3: UAA/UGA Codón de iniciación son reconocidos por el factor RF1 unido a RF-3 con GTP (gasto energía).
TRADUCCIÓN EN EUCARIOTAS: Diferencias principales: - Codón iniciación AUG: Metionina - No ocurre simultáneamente a la transcripción - Proceso de iniciación: no existe secuencia de Shine-Dalagrano, reconocimiento de la modificación CAP, participación de más factores (E delante) que en procariotas.
- Diferencia importante: primero se une el tRNA con su aminoácido y después se une el mRNA con la CAP.
EL CÓDIGO GENÉTICO: Es universal, degenerado (varios tripletes van a codificar por el mismo aminoácido), no ambiguo, no solapado.
Codones STOP: UAA, UAG Codón de iniciación: AUG (metionina) 24 Ariadna Fernández Vilert Famílias: pueden ser compartida (2 aa en 1 casilla con caracteristicas diferentes) o no compartida (1 aa en 1 casilla).
Consecuencia de que el código genético sea degenerado (Tambaleo): Flexibilidad de la tercera base del anticodón, unión muy fuerte para las 2 primeras bases y unión débil para la tercera. Hay menos tRNA que codones.
25 Ariadna Fernández Vilert TEMA 9: LA GENÓMICA Parte de la genética que se encarga del estudio, organización, estructura y función del genoma.
Comprende dos partes a nivel de estudio: estudio molecular de secuencias y la bioinformática.
Los mapas genéticos y físicos pueden diferir en distancias relativas i en la posición de los genes en el cromosoma.
MAPAS FISICOS DE BAJA RESOLUCIÓN - Mapas citológicos: bandas - Mapas de translocaciones: cálculo de distancias entre el punto de translocación y distintos loci de los cromosomas implicados - Mapas de deleciones: mapeo de loci localizados en regiones delecionadas, se constituyen mediante un cruce.
Mapeo por deleción: FISH: hibridación in situ fluorescente para determinar la zona donde se encuentra un gen. Se usan preparaciones cromosómicas tratadas para diluir el cromosoma. Se usa para detectar si hay transcripción.
MAPAS FÍSICOS DE ALTA RESOLUCIÓN 26 - Utilización de electroforesis de campo pulsátil (FGE): Rotación de 120º del campo eléctrico cada 90 segundos.
- Citometría de flujo: marcamos el genoma con un cronocromo, la emisión de fluorescencia está relacionada con la longitud del cromosoma.
- Mapas de restricción: a partir de digestiones simples y dobles. Mapas en los que aparece el DNA y los lugares donde cortaran las enzimas de restricción.
Ariadna Fernández Vilert - Secuenciación: obtener las bases.
Como se hacía antes: secuenciación manual: desnaturalizar la doble cadena de DNA, usar el primer (cebador) y una región complementaria de la cadena a secuenciar. Añadir a la polimerasa los 4 nucleótidos, marcar 1 nucleótido radioactivamente i en 4 cubitos poner 4 nucleótidos (dTTP)+DNA+dd(TP) Actualmente (800 nucleótidos): secuenciación automática, podemos marcar cada nucleótido con un fluorocromo diferente, desnaturalizar, poner el primer + polimerasa+ región complementaria y finalmente se obtienen los cromatogramas : gráficos que resultan de la secuenciación.
ESTRATEGIAS DE SECUENCIACION DEL GENOMA HUMANO - Celera genomics: o - Human genome project (HGP): o 27 “Shot gun “o secuenciación de fragmentos aleatorios: método rápido, privado Secuenciación jerárquica (clon a clon): método lento, público.
Ariadna Fernández Vilert Contig: conjunto de clones ordenados y solapados que constituyen parte del genoma.
Scaffold: conjunto de contigs.
Entre una persona y otra el DNA solo difiere en 0.2%. Genoma humano: 10 veces + pequeño que el de una salamandra. 200 veces + pequeño que el de una ameba.
Estrategia para el solapamiento de contigs: La genómica: Microarrays de DNA (microchips de DNA): Técnica que se usa para ver diferencias de expresión de genes para distintos organismos.
Se usa el mRNA, los genes que se expresen tienen mRNA, necesitamos hibridarlos a cDNA para tener las dos cadenas, usamos la transcriptasa inversa.
Polimorfismos de nucleótido único Como consecuencia de los SNP obtenemos haplotipos.
28 Ariadna Fernández Vilert Haplotipo: juego específico de SNPS y otras variantes genéticas observado sobre un cromosoma o la parte de un cromosoma.
Objetivo: catalogar y mapear SNPs y otras variantes genéticas necesarias para la identificación de haplotipos comunes en poblaciones humanas.
TEMA 10: GENÉTICA DE POBLACIONES POBLACIÓN MENDELIANA Dobzhansky (1950) definió el concepto de población mendeliana como un grupo de individuos que comparten, en el tiempo y en el espacio, un acervo genético común. En esta población se dan los principios mendelianos de la transmisión hereditaria.
- La variación en el seno de las poblaciones es la materia prima de la evolución.
EVOLUCIÓN DESDE LA PERSPECTIVA POBLACIONAL: Es el cambio acumulativo en la composición genética de las poblaciones.
La variación genética o polimorfismo genético: existencia en una población de dos o más formas alélicas en frecuencias apreciables.
- La Frecuencia génica o alélica (unidad básica de evolución): f(A) proporción de un alelo dado en la población variación genética es debida a varios factores: MEDIDA DE LA VARIABILIDAD GENÉTICA - Variación morfológica: textura y color de la semilla de los guisantes de Mendel.
- Variación cromosómica: translocaciones recíprocas, inversiones, cromosomas supernumerarios, etc.
- Polimorfismos inmunológicos: ABO, Rh+, MN - Variación proteica: hemoglobina, enzimas.
- Polimorfismos de ADN. RFLPs, repeticiones en tándem de tamaño variable, SNPs.
FUENTES DE VARIABILIDAD GENÉTICA EN LAS POBLACIONES 29 Ariadna Fernández Vilert - Mutación: fuente de toda la variación existente. Debido a que la tasa de mutación es muy baja esta no puede explicar por si sola la rápida evolución de las poblaciones y especies.
- Recombinación: aunque no genera nueva variación por si misma permite la formación de nuevas combinaciones genéticas.
- Migración: aumento de la variación por la migración de poblaciones con nuevos alelos o con frecuencias alélicas distintas.
Frecuencias alélicas (génicas) y genotípicas Equilibrio de Hardy-Weinberg Ejemplo: 1 locus con 2 alelos: Permite calcular las frecuencias génicas y genotípicas en poblaciones en equilibrio. Permite comparar las frecuencias de poblaciones observadas con las esperadas en equilibrio HardyWeinberg.
Calculo de frecuencias génicas y genotípicas: 30 Ariadna Fernández Vilert Equilibrio H-W Las frecuencias génicas y genotípicas en el “pool” o acervo genético de una población mendeliana, a lo largo del tiempo no varían.
CONDICIONES DEL EQUILIBRIO HARDY-WEINBERG: 31 Ariadna Fernández Vilert Cuando una población está en equilibrio HardyWeinberg, las proporciones de los genotipos son determinadas por las frecuencias de los alelos.
EXTENSIONES DEL EQUILIBRIO HARDY-WEINBERG Cuando hay dominancia entre los alelos se puede estimar las frecuencias alélicas si suponemos que la población está en equilibrio Hardy-Weinberg.
Múltiples alelos, Grupos sanguíneos 32 Ariadna Fernández Vilert DESVIACIONES DEL APAREAMIENTO ALEATORIO Apareamiento clasificado (no al azar): •positivo: tendencia a aparearse con fenotipos semejantes (altura, color de piel,...) •negativo: tendencia a aparearse con fenotipos opuestos •Endogamia: cuando el cruce entre parientes es más común de lo que se espera por azar.
medida de la probabilidad de que dos alelos sean idénticos por ascendencia.
CONSECUENCIAS DE LOS APAREAMIENTOS NO AL AZAR • Desviación de las frecuencias genotípicas de las esperadas por Hardy-Weinberg – Mayor homozigosis: apareamiento clasificado positivo y endogamia – Mayor heterozigosis: apareamiento clasificado negativo •No cambio en las frecuencias alélicas (génicas) HOMOZIGOSIS POR ASCENDENCIA Y POR ESTADO Coeficiente de endogamia (F): mide la probabilidad de que dos alelos sean idénticos por ascendencia. 0<F<1 Si F=0 Apareamiento de la población al azar.
Si F=1 Todos los alelos idénticos por ascendencia.
33 Ariadna Fernández Vilert PROPORCIONES GENOTÍPICAS DE UNA POBLACIÓN CON ENDOGAMIA CÁLCULO DEL COEFICIENTE DE CONSANGUINIDAD A TRAVÉS DE PEDIGRIES F=(2pq-H) /2pq F=1-H/2pq H: proporción total de heterocigotos en la población.
34 Ariadna Fernández Vilert Deriva genética: Es el cambio de las frecuencias alélicas debido a factores aleatorios.
CAUSAS DE LA DERIVA GENÉTICA • Reducción del tamaño de la población por limitaciones de espacio o algún recurso.
• Por efecto fundador: una población es originada a partir de un número bajo de individuos(los fundadores).
• Cuello de botella: reducción drástica en el tamaño de la población.
EFECTOS DE LA DERIVA GENÉTICA • Cambia las frecuencias alélicas dentro de la población.
• Reduce la variabilidad genética dentro de las poblaciones.
• Conduce a la divergencia entre poblaciones con el tiempo.
Variación fenotípica cuantitativa: Es la variación de cualquier carácter fenotípico que toma distintos valores cuantificables en diferentes individuos y no sigue un patrón de herencia mendeliana simple.
Los caracteres que determinan la variación continua se denominan CARACTERES CUANTITATIVOS. Pueden ser: - Característica discontinua: muestra solo algunos fenotipos fácilmente distinguibles.
- Característica continua: muestra un rango continuo de fenotipos.
CARACTERES CUALITATIVOS vs CUANTITATIVOS Vp: varianza fenotípica total Vg: varianza que se debe al genotipo ambiental Ve: varianza Heredabilidad (H2) : proporción de la varianza total fenotípica debida a los efectos de los genes.
Heredabilidad en sentido amplio: h2= Vg /Vp Heredabilidad en sentido restringido: h2= Va / Vp 35 Va: varianza aditiva.
...

Tags:
Comprar Previsualizar